00       00

Click here to search
Bug Report
Report an error

P.abies 1.0 gene MA_895977g0010
Page views 394


Chromosome Start End Confidence Trinity id Subject length Subject coverage Subject strand Query strand
Loading data from server


Gene Description based on Blast2GO: G-type lectin S-receptor-like serine threonine- kinase At1g34300

Populus Transcript name:     Potri.019G086400.1
Arabidopsis id:     AT1G34300.1

Map Image: 


GO ID Name Space Description
GO:0005488molecular_functionbinding
GO:0004672molecular_functionprotein kinase activity
GO:0006487biological_processprotein N-linked glycosylation
GO:0005886cellular_componentplasma membrane

PFAM ID Description
PF00069Protein kinase domain
PF00954S-locus glycoprotein family
PF01453D-mannose binding lectin
PF01636Phosphotransferase enzyme family
PF07714Protein tyrosine kinase
PF08276PAN-like domain

CDS Sequence
Legend:   CDS        STOP                         

>MA_895977g0010[2506 nucleotides] 
CAATTTTGTAGTGAAGAATAGCAGTTCCAACAGCGTTTGGGAGAGCTTTGACAATCCTACTGATACCCTCTTGGTTAATCAAAGTTTCCGTCTGGGACAGAGCCTCCACATGTATCCTTATTCATTCACCCTGGAGTCCAGTGGCAATTTCACATTGAAATGGAGGAACAATATCACATACTGGAATCAGGGTGCCTCTAATGGCTCCAGAGCACGTCTAAACAGTCAAGGGATTTTTACACTCTTCGATTCTTCTGAGGTTCAGCTCAGGATTGCATACAGCAGCGATTACACAGATGCCTCGATCACATTGCGAAGGATCAGGCTTGAATCAGATGGGAATTTGAGGTCCTATGGGTGGGTTAAAAGCTCCGGAACATGGCAACTGGGTTGGAGTGCAGTAGAAGACCAATGCCAAGTGTATGGATGGTGTGGGAACTTTGGGGTGTGTGTTTACAATCACACAGCCCCGTACTGCATATGTCCATCTGCAGATTTCGTTCCCGTAGATCCCAAGGATGCCACACAAGGGTGCAGGAGAGAGCAGGACCTAGTAGGGTGTAGTAACCAGAGCATGGTTTTATTGAACAATACTGAATTCTTCTCTTACCCTCCAGAGTCTGAGTCACAATCGGAGATATACAATTTGGGCATCACAGATTGCAAGCAGAACTGCCTCAGGAATCCACTCTGTTTTGCATCTACAATCATGGCGGATGGTTCGGGCACTTGCCGTATGAAGACTGAGAATTTCACAAGTGCCTATAAATCAGCGGCCATTCCAAGTGCTTCTTATGTAAAGGTATGTGGTCAAGGTCGTCCTCTAGCACCGCCACCCTCTGCAATTATGTTTGTGAGATCAACCAAAGCATCTGCCATTCGAATTGTAGCAGCAGTTGTAGGACCTATCATTGCCTTGATTACTATCCAGATATGCCTCTGGTTTATTTTCTGTAGAAATAATCCGAGGTTTAGATTTGGGCAGCTACCATCCCAATACAGACTTCTGGAATATGCCTCGGGGGCTCCAGTTCAGTTTTCTTACAAGGAGCTTCAGCACTCAACAAAGAATTTTATGGAAAAGTTGGGTTCAGGTGGGTTTGGAACGGTGTACAAGGGAGAATTGCCCAACAAGATAATCGTCGCAGTGAAGCAGCTGGAAGGGATTGAACAAGGGGAGAGACAGTTTCGTATGGAAGTGGCAAACATCAGTAGTACTCATCACTTGAACTTGGTTAGGCTAATCGGATTTTGTTCAGAAGGCCGCCACAGATTACTGGTTTATGAATTCATGAAAAATTCTTCTCTGGACACATTCCTTTTTTCTTCTTCAGAGCAATCCAGGATGCTAGATTGGGATAAGCGGTTCGGTATAGCCCTTGGAACTGCAAGGGGCATCGCCTACTTGCACGAAGAGTGCAGAGATTGCATTGTTCATTGTGATGTTAAACCTGAGAACATACTCCTAGATGATAATTTCAGTGCAAAGGTTTCTGACTTTGGGCTGTCCAAGCTCATCAATCAGAAAGGTCATCGCAAGCGCTCATTGACTAGTGTTCGGGGGACCAGAGGATACTTGGCTCCAGAATGGCTTGCCAATTTACCCATCACTACCAAGTCTGATATTTTTAGTTATGGCATGGTTTTGCTGGAGATCATAAGCGACGAGAAGCTTGGTACGGATGTTAATATTGATCAGGTAAAGAGAGCACTTCAAGTTAGCTTTTGGTGTATCCAGGAGCAACCCTCACAGCGACCAACTATGGGGAAAGTTGTCCAGATGCTGCAAGGGATTTTGCCTATTGACAAACCACCTGCTCCTAAATCTTTGGAAACCTTTCAAAGAAGTACCAGCGGTAGTGCTCGTGAAAGGGCAATCTCAGTGCTTGCAACATCCAGTCATCCAGTTTCTTCTATCTCCTCTGTGAACAGACTCTCCAGCCGCAGAGCTGGAAATAGAAGATTGAATCTCGAGCATCATGATCTAGATCGAGGGTGGCTAGTGGTAAATCCGTTTGGAGTCACTGAGCCTACGGTTGGGTGGAAACGAGCACCCCTCTCAGCAGTCGCGCCACACCTGGTAGGAGGGTGGACTTGGCAACGTCATGAAAGTCCTGGAGTATTCGGACCTGCTCATCGGCATTTCGGTGTTTCGGCACTCGAGAAACCAAAGGGCGAGACCCTTCATCGTCACAGGTCGCGAAATCCCGATTTTGGGTTTCGAGGTTTGAAGAGTCGAAAGACTCGACTCGCTTGCATTTTGAACTCCCGGTTACCGAAATCCCGATACGGCCAGGACGGTCGGATCAGGGGGAAGATTTGTATCCGTCGATCCCAACGAAGGGACGATTTCAAGTTTCAGGGTTGGAGAGTTGAAAGACTCGACTCGCTTGCATTTCAAACTCCTGGTTACCGAAATCACGATACAGCCAAGACTGTCGGATCAGGGGGAAGATTTGCAGCCGTCGATCCCAACAAAGGGACGATTTCGGGTTTCGGGGTTTGA
   



Genomic Sequence (+ strand)     upstream:    downstream:   
Legend:   CDS                         

>MA_895977:1-5718[5718 nucleotides] 
CAATTTTGTAGTGAAGAATAGCAGTTCCAACAGCGTTTGGGAGAGCTTTGACAATCCTACTGATACCCTCTTGGTTAATCAAAGTTTCCGTCTGGGACAGAGCCTCCACATGTATCCTTATTCATTCACCCTGGAGTCCAGTGGCAATTTCACATTGAAATGGAGGAACAATATCACATACTGGAATCAGGGTGCCTCTAATGGCTCCAGAGCACGTCTAAACAGTCAAGGGATTTTTACACTCTTCGATTCTTCTGAGGTTCAGCTCAGGATTGCATACAGCAGCGATTACACAGATGCCTCGATCACATTGCGAAGGATCAGGCTTGAATCAGATGGGAATTTGAGGTCCTATGGGTGGGTTAAAAGCTCCGGAACATGGCAACTGGGTTGGAGTGCAGTAGAAGACCAATGCCAAGTGTATGGATGGTGTGGGAACTTTGGGGTGTGTGTTTACAATCACACAGCCCCGTACTGCATATGTCCATCTGCAGATTTCGTTCCCGTAGATCCCAAGGATGCCACACAAGGGTGCAGGAGAGAGCAGGACCTAGTAGGGTGTAGTAACCAGAGCATGGTTTTATTGAACAATACTGAATTCTTCTCTTACCCTCCAGAGTCTGAGTCACAATCGGAGATATACAATTTGGGCATCACAGATTGCAAGCAGAACTGCCTCAGGAATCCACTCTGTTTTGCATCTACAATCATGGCGGATGGTTCGGGCACTTGCCGTATGAAGACTGAGAATTTCACAAGTGCCTATAAATCAGCGGCCATTCCAAGTGCTTCTTATGTAAAGGTATGTGGTCAAGGTCGTCCTCTAGCACCGCCACCCTCTGCAATTATGTTTGTGAGATCAACCAAAGCATCTGCCATTCGAATTGTAGCAGCAGTTGTAGGACCTATCATTGCCTTGATTACTATCCAGATATGCCTCTGGTTTATTTTCTGTAGAAATAATCCGAGGTTTAGATTTGGGCAGCTACCATCCCAATACAGACTTCTGGAATATGCCTCGGGGGCTCCAGTTCAGTTTTCTTACAAGGAGCTTCAGCACTCAACAAAGAATTTTATGGAAAAGTTGGGTTCAGGTGGGTTTGGAACGGTGTACAAGGGAGAATTGCCCAACAAGATAATCGTCGCAGTGAAGCAGCTGGAAGGGATTGAACAAGGGGAGAGACAGTTTCGTATGGAAGTGGCAAACATCAGTAGTACTCATCACTTGAACTTGGTTAGGCTAATCGGATTTTGTTCAGAAGGCCGCCACAGATTACTGGTTTATGAATTCATGAAAAATTCTTCTCTGGACACATTCCTTTTTTCTTCTTCAGAGCAATCCAGGATGCTAGATTGGGATAAGCGGTTCGGTATAGCCCTTGGAACTGCAAGGGGCATCGCCTACTTGCACGAAGAGTGCAGAGATTGCATTGTTCATTGTGATGTTAAACCTGAGAACATACTCCTAGATGATAATTTCAGTGCAAAGGTTTCTGACTTTGGGCTGTCCAAGCTCATCAATCAGAAAGGTCATCGCAAGCGCTCATTGACTAGTGTTCGGGGGACCAGAGGATACTTGGCTCCAGAATGGCTTGCCAATTTACCCATCACTACCAAGTCTGATATTTTTAGTTATGGCATGGTTTTGCTGGAGATCATAAGCGGTAGAAGGAATTTCGATACCTTGGCATGGTTTTGCTGGAGATCATAAGCGGTAGAAGGAATTTCGATACCTCGACGTCGAGGAGGAAGAAATTCTCAATATGGGCGTTTGAGGAATTTGAAAGTGGAAACATCCTGAACATTACAGACGAGAAGCTTGGTACGGATGTTAATATTGATCAGGTAAAGAGAGCACTTCAAGTTAGCTTTTGGTGTATCCAGGAGCAACCCTCACAGCGACCAACTATGGGGAAAGTTGTCCAGATGCTGCAAGGGATTTTGCCTATTGACAAACCACCTGCTCCTAAATCTTTGGAAACCTTTCAAAGAAGTACCAGCGGTAGTGCTCGTGAAAGGGCAATCTCAGTGCTTGCAACATCCAGTCATCCAGTTTCTTCTATCTCCTCTGTGAACAGACTCTCCAGCCGCAGGTAGCTATCTTTTCATGGCCACTTAAGTCCCACGACAAGACAGGTTTTATCTTCATTCCTCTTCAATCTGATCAATGGAAGCATCACCATTACTTGGTTTTAGTGTAAAATTCAGAGAAAAGGAATTATTTTGTCAGTTTCAAGTGATATACCGTTAGTTAAAACGCTCCTATGGTTTTTCTTAAAGATGGCAACTCTCATTCTCGGTTCTTAATAGGTATCTTTACTGCTATGATAATGATATAGATATGAAATTTATTATTTTTAAAATGTTATGATGTTAGATACAGTTGTACCTTTATTATGAAATTTAATATTTTTAAAACGATGTGAGACATCGTTGGTTAAAGACTCAAGTAGATGTGATATAAATATTTTTATTTTGAAAAAGTTTAACTTGTTTAAATTTTTTTTTTATTCATTATTATTAAATTTTGAATTAAATCATTTTAATTGAAATTATAATTTTGAATTGATAAAATTATTGTTTTTAATGAAAAAAGATTAACTATCTTGTTAATTGTTAATATATTATATTTTAATTAAAAAATTTAATTTTAAATTTAATTTTTTTCAGCATTATTACTATAAATACTTATATAACAATTACCTTTTACAATTTTATTATTTTATTATTTATAATTTCATCAATTCAAAATGATACATACATCTTATATAACAATTAAATTTTACAATCTTAATATTTTATTATTTATAATTCATCAATTCAAAAAATATATAAAAACAAAATTATGTTAAAAATATATTTCTCTTTCCACTTATTTTAAACTACTTTAATTTTTAGTCAGAACTCATGCAAACTTCTCCTATAATTTAGGAATAAAAAAAATAAATCGTAAATCCACCCTCTTGCCAGTCTCAACTGACTCATTCCGCCTCCTGTGGGGCTAACAGACAGCTCTAAGAGCTTGTAAATCAACCCACTCGTTCCACCTTTCACGCCCGCATTCATTACTCTGTAGATTTCAAAACCAAGGTTGTGTTCATTGCCGCAACCAGTCAACGGGTTGGAGTCTCATATAATGGACACGTGGCATGTTTATCTTTTCATGGTTGTGTATGTGATAAGATACTTTATTATGTATACTGTGTATTTGATAAAATAAAAAAGTTTGATTTAAATATACTTATTACTTAATCACTTAGTTTTAACTTTGATTGGAATATACTTATTACTTAATCACTTATAAAACTGTTTTGTTTTTTATTGATATAGATTTTTTAGAGATATTTTACTATTACTTTATAACTTTATATGATATAAAAAAACAAATTAGTAAAATAGTGTTTATATAAATTCTCTTTCTCTTTTTCTTCTAAGTCAAATTTCATATCTTATATTATTATAATAAGGATAAGGATGGGTTAAATATTATGTTCTTTTATGTTTTTATGTTCCTTCATAATTCAAAGACATGCTTTAATGTTTGGGGAACTTATTATTGTTAAGTCAAATTTCATATCTTATATTATTATAATAAGGATCCGGATGGGTTAGATATTATATTCTTTTATGTTTTTATGCTCCTTCATAATTCAAAGACATGCTTTAATGTTTGATATTTTATGTTATTATATGTTCCTTTATAATTCAAAGACATGCTTTAATGTTTGGGGAACTTATTATTGTTAATTAATTGCATTTTTGTCAATGCAATTTTGTTATTATTTATTTTTTTGTTGTTGTTGTTGTTAAGATCAGTCTTGTAATGGTGGAGGGAAAAATTATAGTGTAGTGGGAAGAAATATATGTAGATCATTAGCAAACAATGAATATTTAGTAACAATTGGTCAATTAATCATTGGTGGTTTTCAGTGTGTAGAATTGGAAAATTATAAATGGTTTATGGTTTTTTGTTATGTCTATTTATTAATTGTTAGGGTTGGAGAAAAATGGAGTGTGAGTTTTAACTTAGTGTTATGCTATCGCTTTTTTTCTAGGATCCTTATGCCACTGCTAAACACTCTTATTGAGAGCATGGAGTCTCTATAGATCACAAGAAGACAATCAATACTTAGCAATAGTTGGTCAATTAATACAGGGAGTTTTGAACAGGGGAATCGTGGAAGAGAATCGAGAGAAAATCGAGAAATACAGGGAGTTTTGAACAGGGGAGAAGGATAGTAACCTTCGTCCTTGACTTTCGTAGAGCTGGAAATAGAAGATTGAATCTCGAGCATCATGATCTAGATCGAGGGTGGCTAGTGGTAAATCCGTTTGGAGTCACTGAGCCTACGGTTGGGTGGAAACGAGCACCCCTCTCAGCAGTCGCGCCACACCTGGTGTTTTCTGATAAGTGTTATGTCTTGTATTTTTGAACTAAATACATGCTCATGTTTATACGCTCATAAATGGTTTCTGCATGGAAGTGTTTGCCTGTGTTTTGATTTGGAGACAAGGGATACATGCTTATACTTATATGATGTGTTTTGATTTGGAGACAAGGGATACATGCTTATACTTATATGACCAAAATTGGTCTATGTATATAATGAGTAGGTTTAGAATACGAGTCTGTTCCCTTGAGAATTGTCTTATCTACTAGGCTCGTGCTATGCCCCGGTTTAATTCCCCGAAGGCACTTCTCTCGTAAAGTTCCCTCGCACTCCAAAGTCGGAGTGAGTCCCTTGAAAGGACTACCATGATAGTAAACCCACGAATTTACTTTACCCCTACCACCAAATTTATAGCACGACGAATTAGGAAGACTTTACTCATGCCACCAAGCCTAGGGATAATTTACCCAAGAACCCTCTGAAAGATCTGTCAGAGCTCTATTGCCCATTGACAATTAACCTTTGCATAGGTAGGAGGGTGGACTTGGCAACGTCATGAAAGTCCTGGAGTATTCGGACCTGCTCATCGGCATTTCGGTGTTTCGGCACTCGAGAAACCAAAGGGCGAGACCCTTCATCGTCACAGGTCGCGAAATCCCGGTATGCGAAACTCCGAATTAGCTTAGTGTGAATAGATTTCGGCATTTCGGCGTTTCGACACCTAGGAAACCAAAGGGCAAGACCCTTCGCCATCGCAATTCATGAAGTCTCGGTATGTGAAACTCTAAATTAGCTTAGCGTGAATAGATTTCGGCATTTCGGTGTTTTGACACCCAGGAAACCAAAGGGCGAGACCCTTTGTCGTCGCAAGTCGCGTAGTCCTAGTATGCAAAACTCTGAATTAGCTTAGCGTGAATAGATTTCGGCATTTCGGTGTTTTGGTACCCGGGAAACCAAAGGGCGAGACCCTTCGTTGTCACAAGTCGCGAAGTCCCGGTATGCGAAACTCTGAATCAGCTTAGTGTGAATAGATTTTGGGTTTCGAGGTTTGAAGAGTCGAAAGACTCGACTCGCTTGCATTTTGAACTCCCGGTTACCGAAATCCCGATACGGCCAGGACGGTCGGATCAGGGGGAAGATTTGTATCCGTCGATCCCAACGAAGGGACGATTTCAAGTTTCAGGGTTGGAGAGTTGAAAGACTCGACTCGCTTGCATTTCAAACTCCTGGTTACCGAAATCACGATACAGCCAAGACTGTCGGATCAGGGGGAAGATTTGCAGCCGTCGATCCCAACAAAGGGACGATTTCGGGTTTCGGGGTTTGA
   



Peptide Sequence
>MA_895977p0010[834 residues] 
NFVVKNSSSNSVWESFDNPTDTLLVNQSFRLGQSLHMYPYSFTLESSGNFTLKWRNNITYWNQGASNGSRARLNSQGIFTLFDSSEVQLRIAYSSDYTDASITLRRIRLESDGNLRSYGWVKSSGTWQLGWSAVEDQCQVYGWCGNFGVCVYNHTAPYCICPSADFVPVDPKDATQGCRREQDLVGCSNQSMVLLNNTEFFSYPPESESQSEIYNLGITDCKQNCLRNPLCFASTIMADGSGTCRMKTENFTSAYKSAAIPSASYVKVCGQGRPLAPPPSAIMFVRSTKASAIRIVAAVVGPIIALITIQICLWFIFCRNNPRFRFGQLPSQYRLLEYASGAPVQFSYKELQHSTKNFMEKLGSGGFGTVYKGELPNKIIVAVKQLEGIEQGERQFRMEVANISSTHHLNLVRLIGFCSEGRHRLLVYEFMKNSSLDTFLFSSSEQSRMLDWDKRFGIALGTARGIAYLHEECRDCIVHCDVKPENILLDDNFSAKVSDFGLSKLINQKGHRKRSLTSVRGTRGYLAPEWLANLPITTKSDIFSYGMVLLEIISDEKLGTDVNIDQVKRALQVSFWCIQEQPSQRPTMGKVVQMLQGILPIDKPPAPKSLETFQRSTSGSARERAISVLATSSHPVSSISSVNRLSSRRAGNRRLNLEHHDLDRGWLVVNPFGVTEPTVGWKRAPLSAVAPHLVGGWTWQRHESPGVFGPAHRHFGVSALEKPKGETLHRHRSRNPDFGFRGLKSRKTRLACILNSRLPKSRYGQDGRIRGKICIRRSQRRDDFKFQGWRVERLDSLAFQTPGYRNHDTAKTVGSGGRFAAVDPNKGTISGFGV*
   



PlantGenIE GeneLists

Gene Family Genes
Amborella trichopodascaffold00017.63; scaffold00017.67; scaffold00103.84; scaffold00068.90;
Oryza sativa ssp. japonicaOS03G62180;
Picea abiesMA_78595g0010; MA_5147g0010; MA_895977g0010; MA_7917g0010; MA_10426650g0010; MA_132342g0010; MA_91618g0010; MA_208216g0010; MA_10433041g0010; MA_202714g0010; MA_69585g0010; MA_126451g0020;
Pinus taedaPITA_000010770-RA; PITA_000057028-RA; PITA_000026418-RA; PITA_000039323-RA; PITA_000010766-RA; PITA_000070393-RA; PITA_000000064-RA; PITA_000092193-RA; PITA_000076221-RA; PITA_000038188-RA; PITA_000068370-RA; PITA_000035863-RA; PITA_000075905-RA; PITA_000002882-RA; PITA_000071608-RA; PITA_000010764-RA; PITA_000083463-RA; PITA_000062713-RA; PITA_000082318-RA; PITA_000086506-RA; PITA_000046598-RA; PITA_000077721-RA; PITA_000026666-RA; PITA_000051097-RA; PITA_000032910-RA; PITA_000083464-RA; PITA_000047189-RA; PITA_000086505-RA; PITA_000047190-RA; PITA_000082900-RA; PITA_000050875-RA; PITA_000026667-RA;
Populus trichocarpaPotri.013G115700; Potri.019G086200; Potri.019G086400; Potri.013G115800; Potri.019G086300; Potri.001G006100;
Selaginella moellendorffiiSM00070G01740; SM00002G02410;
Vitis viniferaVV18G16760;
Zea maysZM01G58990;

Map Image: 


Login | © 2019 PlantGenIE.org.| All our tools are under MIT License

  • GeneList
      view active genelist () here.
      genelist namegenesrename/delete
      add new genelist / save current list / cancel
  • Analysis
  • <