00       00

Click here to search
Bug Report
Report an error

P.abies 1.0 gene MA_71765g0010
Page views 346


Chromosome Start End Confidence Trinity id Subject length Subject coverage Subject strand Query strand
Loading data from server


Gene Description based on Blast2GO: Beta-glucosidase 40

Populus Transcript name:     Potri.008G094200.3
Arabidopsis id:     AT1G26560.1

Map Image: 


GO ID Name Space Description
GO:0048046cellular_componentapoplast
GO:0016023cellular_componentcytoplasmic membrane-bounded vesicle
GO:0009507cellular_componentchloroplast
GO:0005975biological_processcarbohydrate metabolic process
GO:0043169molecular_functioncation binding

PFAM ID Description
PF00150Cellulase (glycosyl hydrolase family 5)
PF00232Glycosyl hydrolase family 1

CDS Sequence
Legend:   CDS        START        STOP                         

>MA_71765g0010[1485 nucleotides] 
ATGAGCGCTGCTTATCTGTTCTTTGTTGTTGTGAACGTTGTTCTGTCCAATGTACTGCACAGATCGGAAGCGAAATGTGGGCCAAACTCGACAGCAGATTTTAGCAGAAAGAATTTTCCTCCTGGATTTGTATTTGGCACGGCCTCCTCAGCATTTCAGTACGAGGGTGCAGTAAAAGAAGATGGGAGAGGACCCAGTGTGTGGGATACGTATTCTCATAAAATTGGGCATATTCTGGATTCCAGCAACGCAGACGTTGCAGTCGACCAGTATAACCGTTACAGGGAAGATATCCGGCTAATGGTGGATATGGGGATGGATGCCTACAGATTTTCCATCTCCTGGTCACGAATATTTCCCGATGGAAGTGGACATATTAATGAAGCAGGAGTCGATCATTACAATAAGTTCATAGATGCGCTTTTGGAAAACGGAATCGAGCCATATTTGACTCTGTATCACTGGGACCTTCCAGAGGCGCTCGAGGATGCCTATAATGGTTGGCTCAGCTCCAAAATTGTAGACGACTATACGAATTATGCAGAAACATGCTTTGAGAAATTCGGAGATAGAGTGAAAAACTGGATAACATTCAACGAGCCACACACGTTTGCTATTGATGGCTACGATGAGGGTTTCTTGGCACCGGGGCGATGCTCCTCTTGTGCCGCTGGGAATTCGGGCACCGAGCCCTATATCGTTGCTCATAACGTGCTCCTTTCTCATGCCAAAACTGTGGACATATACAGGACAAAGTATAAGGCAAAGCAAGGCGGAAGAATCGGTATTTCCTTAGACGTCATCTGGTACCAACCCATGTCCGATTCTCCTGAAGATGTTGCTGCTACACAGAGAGCCCAGGATTTCCAATTGGGATGGTTCATGGATCCGCTGTTTTTCGGTGATTATCCGGCGTCAATGAGAGAGAGAGTCGGCAACCGACTGCCGGCATTTTCGGCAGAAGAGTCGAATCGCGTAAAAGGGTCGTTGGATTTCGTGGGTGTGAACCATTACACCACATATTACGCGAGGAACAACCCAACCTTCTCGGATTCCGGAGCTGTTACCCTCCCGTTGAGGAATGGAGCAGCCATAGGTGACAGAGCATGGTCAATATGGCTCTACATAGTGCCCTGGGGAATCCGGAGTCTCATGAATTACATTAAACAGCGTTACAATAATCCTCCCGTCATTATCACGGAAAACGGAATGGACGACTACAACAATATTTCGATTCCTCTGGAAAAAGCGTTGAACGATCAAACACGGATCAAATATCATGCAGATTATCTCTCCAACCTTTCTGCAGCTATCCAGGAGGATGGGTGTGACGTGCGCGGGCATTTTGTGTGGTCTCTGTTGGACAACTGGGAGTGGGCAGCAGGATACACTTCGAGATTTGGGCTCTACTTTGTTGATTACAACCACAATCTCACCAGATATCCCAAGGCTTCCGTCCACTGGTTCAAATGTTTTCTGCAATGA
   



Genomic Sequence (+ strand)     upstream:    downstream:   
Legend:   CDS                         

>MA_71765:8931-12517[3587 nucleotides] 
ATGAGCGCTGCTTATCTGTTCTTTGTTGTTGTGAACGTTGTTCTGTCCAATGTACTGCACAGATCGGAAGCGAAATGTGGGCCAAACTCGACAGCAGATTTTAGCAGAAAGAATTTTCCTCCTGGATTTGTATTTGGCACGGCCTCCTCAGCATTTCAGGTTAAAAATAATCATTGAAACACTTCCTTTGCTCCTTTGTACGACTAGTCTGATTCTGAACCATTGATATTAATATGCCGCTTTGCAGTACGAGGGTGCAGTAAAAGAAGATGGGAGAGGACCCAGTGTGTGGGATACGTATTCTCATAAAATTGGTAGTGGTTTTCAAGAGCAATCCGTGTTTTTAATCCTTTGTTTGTAAATAGTATAAACCATTTAAAACCATGTGAACAATATTGATTTTACAGGGCATATTCTGGATTCCAGCAACGCAGACGTTGCAGTCGACCAGTATAACCGTTACAGGGTCAGATTTCCAACCTCCCAATAAAACCGAGCTGTAAGAAGGAATGTGTGTAGGGTAATAATCATATGCGAATATGTTATGCAGGAAGATATCCGGCTAATGGTGGATATGGGGATGGATGCCTACAGATTTTCCATCTCCTGGTCACGAATATTTCCCGGTAAGATAAACTTACTTGCCACCTCCACTATTTCAGATCCGTTGGTCATTGCTTTTAAATCTTTATAAGAATACTGATCGATCCGTAGAGGGATGAATGAATTCGAGCACATGCATAGATGGAAGTGGACATATTAATGAAGCAGGAGTCGATCATTACAATAAGTTCATAGATGCGCTTTTGGAAAACGGTATGATTCAATAGAAATTAGTAAAGTTTATGATAATTTGATCTTGATTAATTCTAAAGGTGTATACCTATTGGAAATACCTATTGGAAATAGTTACATTTCATTATTTTTTAATCATAAATTTTTGTCATACTTCTAAATTAATGGATGAAATTTCATGTTCATAACTTTATTGTATTTTTTTTAGGGTGTAAGTTAACCTGTTTACTTTTTATATTCAAATAATTAATCAAACTTAATATGATTAAAAAATTACTGTGTAACCATCTAATTGTTACGTTCAAATCTTTTTCAAATGATTATCAAACTTAATTCCAACCCTTTTATATTATCCTTTCCGAATTTTCATAAACCTGATATCAATTAAGGTTTTCTTTTTAAAATTTTACCAACCAAAACCTTAAAACCTTTAAACATTCACCAACCACGAATTTGCTGCTGTGCTAGTTATAAGTATATCTAACTTAACCTCTTGAGAAAAAGTTACAGGAATCGAGCCATATTTGACTCTGTATCACTGGGACCTTCCAGAGGCGCTCGAGGATGCCTATAATGGTTGGCTCAGCTCCAAAATTGTGTAAGGCCTTTATTCCTATTAGTATACGCAGAACATTGCAGTTTTGTTCATAATTGAAATCAATTTGCAGCATAAATTCACTGTTCGTTTCTTATGCCTGGCCTGCAGAGACGACTATACGAATTATGCAGAAACATGCTTTGAGAAATTCGGAGATAGAGTGAAAAACTGGATAACATTCAACGAGCCACACACGTTTGCTATTGATGGCTACGATGAGGGTTTCTTGGCACCGGGGCGATGCTCCTCTTGTGCCGCTGGGAATTCGGGCACCGAGCCCTATATCGTTGCTCATAACGTGCTCCTTTCTCATGCCAAAACTGTGGACATATACAGGACAAAGTATAAGGTATTTGTTTTCACTGTCTGCTATATTTGCTCTATACAATTGGTTTGTGGCTGCTATATTTGCTCCTTGGGCGCCTGTTTAGGGAACTAATTGTGAATTGGCAGTTAGGCAAATCAAATTTTTAATTAGGGGAAAGGATTATATTTATTGGAAATGGTCATATTTAATCATTTTTTAATTATAAATTTTAATTTTATAGTTATTAATTGAAGATGCTGATATATTCTTTGTCATTTTTTCAAATCAATAAATGAAATTTTATGTTTATAACTTTCTTGTATTTTTTAGGACATCAGTTAAACTGTTTACTTTTTAACATTTACTTAATATAACTAAAAAATTACTGTTAACTATCTAATTGCCGAGTTCAAATGATTACCAAACTTAATTCCAACCCTTTCATATTCTCCATTCCAGATTTTCATGAACCTTATGTTAATTACTATTTTCTTTTGAAAATTTTACCAACCAAAACCTTTGGTCATTACCAACCACGAATTTACCGATGTGCTAGTTTATCGCCAGAGACGTAAGCAGAATTGTAATAATTTCCCGGGATAGGATTCCACCGTCACATATATTACCTCTTTCAAATTTGATAGTAAATTAGAAATGAATGCCGCAGGCAAAGCAAGGCGGAAGAATCGGTATTTCCTTAGACGTCATCTGGTACCAACCCATGTCCGATTCTCCTGAAGATGTTGCTGCTACACAGAGAGCCCAGGATTTCCAATTGGGATGGTAAGTACATGGCATGGCAGTAAACCTTAAAATCCATCCATCTCTTCAAAATAACTATACTCGACTAATATAATAATCATGTTTCATGGCCTGCAGGTTCATGGATCCGCTGTTTTTCGGTGATTATCCGGCGTCAATGAGAGAGAGAGTCGGCAACCGACTGCCGGCATTTTCGGCAGAAGAGTCGAATCGCGTAAAAGGGTCGTTGGATTTCGTGGGTGTGAACCATTACACCACATATTACGCGAGGAACAACCCAACCTTCTCGGATTCCGGAGCTGTTACCCTCCGTGAGTTTCGCAACCCTTTTACTTTCGTGAAAGTTTAGAATATATATATATATATATAACTTAAGTTTTTTCTTAAATTGAAAAGCAAAGTCTTTGACTGTATCGTTTCCGGTTTCTTGACAGCGTTGAGGAATGGAGCAGCCATAGGTGACAGAGTGAGTGTCAGCTTTTTTTAACAAAGAAAACGAGAATTGGGTTTGATCACTGTCGTTATGATACAGGACATGAATAGTTGCCACATTCTATTTACTTGCTTGTGCAGGCATGGTCAATATGGCTCTACATAGTGCCCTGGGGAATCCGGAGTCTCATGAATTACATTAAACAGCGTTACAATAATCCTCCCGTCATTATCACGGAAAACGGTAATTATCTTCTCTTCTGTTCTGCAATTGATCTTTCTCGTCATTAATAATAATAACGTGAATTCATTGATTCGGCAGGAATGGACGACTACAACAATATTTCGATTCCTCTGGAAAAAGCGTTGAACGATCAAACACGGATCAAATATCATGCAGATTATCTCTCCAACCTTTCTGCAGCTATCCAGTAAGCAAGCAATTCGGAGGTCTTATTATAAATCAAATAATTAGTAGAGACAACCAATTGACTGTGTATTTTATTAATGGTGGACTGGTACAGGGAGGATGGGTGTGACGTGCGCGGGCATTTTGTGTGGTCTCTGTTGGACAACTGGGAGTGGGCAGCAGGATACACTTCGAGATTTGGGCTCTACTTTGTTGATTACAACCACAATCTCACCAGATATCCCAAGGCTTCCGTCCACTGGTTCAAATGTTTTCTGCAATGA
   



Peptide Sequence
>MA_71765p0010[494 residues] 
MSAAYLFFVVVNVVLSNVLHRSEAKCGPNSTADFSRKNFPPGFVFGTASSAFQYEGAVKEDGRGPSVWDTYSHKIGHILDSSNADVAVDQYNRYREDIRLMVDMGMDAYRFSISWSRIFPDGSGHINEAGVDHYNKFIDALLENGIEPYLTLYHWDLPEALEDAYNGWLSSKIVDDYTNYAETCFEKFGDRVKNWITFNEPHTFAIDGYDEGFLAPGRCSSCAAGNSGTEPYIVAHNVLLSHAKTVDIYRTKYKAKQGGRIGISLDVIWYQPMSDSPEDVAATQRAQDFQLGWFMDPLFFGDYPASMRERVGNRLPAFSAEESNRVKGSLDFVGVNHYTTYYARNNPTFSDSGAVTLPLRNGAAIGDRAWSIWLYIVPWGIRSLMNYIKQRYNNPPVIITENGMDDYNNISIPLEKALNDQTRIKYHADYLSNLSAAIQEDGCDVRGHFVWSLLDNWEWAAGYTSRFGLYFVDYNHNLTRYPKASVHWFKCFLQ*
   



PlantGenIE GeneLists

Gene Family Genes
Amborella trichopodascaffold00005.227; scaffold00005.226; scaffold00005.228; scaffold00095.27; scaffold00066.201; scaffold00043.52; scaffold00057.291; scaffold00057.290; scaffold00022.233; scaffold00149.40; scaffold00045.325; scaffold00149.41; scaffold00149.37; scaffold00149.38; scaffold00149.39; scaffold00016.351; scaffold00016.350; scaffold00062.23; scaffold00022.231; scaffold00022.232; scaffold00095.31; scaffold00110.65; scaffold00095.28; scaffold00022.234; scaffold00022.236; scaffold00095.29; scaffold00022.235; scaffold00028.30;
Arabidopsis thalianaAT3G18080; AT3G18070; AT1G26560; AT5G54570; AT5G44640; AT5G42260; AT2G44450; AT3G60130; AT2G44480; AT1G61820; AT5G24550; AT5G24540; AT4G27830; AT4G27820; AT3G60140; AT2G44460; AT2G44470; AT4G22100; AT3G60120; AT2G44490; AT1G51470; AT1G47600; AT3G62750; AT1G45191; AT3G21370; AT1G75940; AT2G32860; AT1G60090; AT1G52400; AT3G03640; AT5G26000; AT3G09260; AT5G28510; AT1G66280; AT1G66270; AT2G25630; AT5G25980; AT3G62740; AT4G21760; AT1G60270; AT1G60260; AT5G36890; AT1G02850; AT5G48375; AT1G61810; AT5G16580; AT1G51490;
Oryza sativa ssp. japonicaOS07G46280; OS03G49610; OS12G23170; OS10G17650; OS03G11420; OS04G39900; OS06G46940; OS04G39880; OS06G21570; OS09G31430; OS09G33680; OS09G33690; OS04G43390; OS01G32364; OS04G43410; OS08G39870; OS03G49600; OS01G59840; OS01G70520; OS01G59819; OS05G30280; OS08G39860; OS04G43360; OS05G30350; OS09G31410; OS09G33710; OS11G08120; OS05G30300; OS05G30390; OS05G30250; OS01G67220; OS04G39864; OS04G43400; OS04G39840; OS04G43380; OS04G39814; OS05G30320; OS03G20710;
Oryza sativa ssp. japonicaOL11G02150;
Physcomitrella patensPP00076G00030; PP00138G00100; PP00110G00290; PP00001G03940; PP00022G01740; PP00114G00740; PP00009G00460; PP00137G00160; PP00170G00410; PP00039G00670; PP06328G00010; PP00001G03880; PP00002G01740; PP00002G01730; PP00020G00910;
Picea abiesMA_71765g0010; MA_4535g0010; MA_484764g0010; MA_82706g0010; MA_10431526g0010; MA_10434198g0010; MA_48585g0010; MA_10394370g0010; MA_8849054g0010; MA_488148g0010; MA_8591669g0010; MA_139193g0010; MA_8033g0010; MA_356467g0010; MA_10344118g0010; MA_101776g0010; MA_10431319g0010; MA_10425819g0010; MA_10436515g0030; MA_10426536g0010; MA_10429137g0030; MA_70066g0010; MA_9186460g0010; MA_119005g0010; MA_119280g0010; MA_10426205g0010; MA_48480g0010; MA_10425794g0010; MA_12813g0010; MA_8474719g0010; MA_483593g0010; MA_952732g0010; MA_10436515g0010; MA_10436515g0020; MA_6507007g0010; MA_10182879g0010; MA_10325280g0010; MA_781664g0010; MA_946576g0010; MA_10425794g0020; MA_10427205g0010; MA_10429137g0020; MA_802989g0010; MA_10330649g0010; MA_1160456g0010; MA_31837g0010; MA_173229g0010; MA_9867037g0010; MA_252515g0010; MA_76569g0010; MA_7255973g0010; MA_48480g0020; MA_19661g0010; MA_940685g0010; MA_119716g0010; MA_119089g0010; MA_870335g0010; MA_10427912g0010; MA_10432745g0010; MA_62006g0010; MA_3059351g0010; MA_807157g0010; MA_10376046g0010; MA_63392g0010; MA_255381g0010; MA_8549728g0010; MA_5481649g0010; MA_10428184g0010; MA_160790g0010; MA_492206g0010; MA_245090g0010;
Pinus taedaPITA_000029139-RA; PITA_000047875-RA; PITA_000037222-RA; PITA_000007048-RA; PITA_000007051-RA; PITA_000007050-RA; PITA_000029426-RA; PITA_000007049-RA; PITA_000000089-RA; PITA_000021271-RA; PITA_000018056-RA; PITA_000075901-RA; PITA_000020650-RA; PITA_000018053-RA; PITA_000042337-RA; PITA_000034012-RA; PITA_000080741-RA; PITA_000076560-RA; PITA_000054563-RA; PITA_000018050-RA; PITA_000004696-RA; PITA_000054826-RA; PITA_000024144-RA; PITA_000027846-RA; PITA_000023494-RA; PITA_000003192-RA; PITA_000023496-RA; PITA_000076245-RA; PITA_000036151-RA; PITA_000047308-RA; PITA_000086236-RA; PITA_000028065-RA; PITA_000074111-RA; PITA_000027845-RA; PITA_000034013-RA; PITA_000022073-RA; PITA_000050055-RA; PITA_000040874-RA; PITA_000004695-RA; PITA_000004693-RA; PITA_000021854-RA; PITA_000004697-RA; PITA_000023855-RA; PITA_000081176-RA; PITA_000030343-RA; PITA_000004689-RA; PITA_000056962-RA; PITA_000078367-RA; PITA_000095546-RA; PITA_000034662-RA; PITA_000085088-RA; PITA_000056376-RA; PITA_000022731-RA; PITA_000044751-RA; PITA_000073503-RA; PITA_000063768-RA; PITA_000084784-RA; PITA_000020647-RA; PITA_000085402-RA; PITA_000027753-RA; PITA_000041270-RA; PITA_000070125-RA; PITA_000051350-RA; PITA_000055425-RA; PITA_000017653-RA; PITA_000091706-RA; PITA_000027754-RA; PITA_000031443-RA; PITA_000017741-RA; PITA_000057275-RA; PITA_000059567-RA; PITA_000069165-RA; PITA_000033147-RA; PITA_000065343-RA; PITA_000045781-RA; PITA_000085413-RA; PITA_000086314-RA; PITA_000073937-RA; PITA_000012585-RA; PITA_000064483-RA; PITA_000085058-RA; PITA_000079138-RA; PITA_000080588-RA; PITA_000064075-RA; PITA_000089597-RA; PITA_000092019-RA; PITA_000032416-RA; PITA_000076912-RA; PITA_000096310-RA; PITA_000032415-RA; PITA_000026333-RA; PITA_000027752-RA; PITA_000079495-RA; PITA_000087546-RA; PITA_000029140-RA; PITA_000030707-RA; PITA_000003189-RA; PITA_000090623-RA; PITA_000024222-RA; PITA_000074261-RA; PITA_000072735-RA; PITA_000021272-RA; PITA_000007555-RA; PITA_000012584-RA; PITA_000080220-RA; PITA_000037204-RA; PITA_000026704-RA; PITA_000056463-RA; PITA_000057930-RA; PITA_000088618-RA; PITA_000049963-RA; PITA_000073936-RA; PITA_000039204-RA; PITA_000096419-RA; PITA_000040510-RA; PITA_000029638-RA; PITA_000094741-RA; PITA_000092364-RA; PITA_000075332-RA; PITA_000026613-RA; PITA_000077771-RA; PITA_000064280-RA; PITA_000095753-RA; PITA_000024124-RA; PITA_000080983-RA; PITA_000046221-RA; PITA_000077925-RA; PITA_000092365-RA; PITA_000079964-RA; PITA_000056691-RA; PITA_000087534-RA; PITA_000017742-RA; PITA_000096311-RA; PITA_000026611-RA; PITA_000073502-RA; PITA_000010765-RA; PITA_000000401-RA; PITA_000032347-RA; PITA_000067968-RA; PITA_000004694-RA; PITA_000041268-RA; PITA_000070582-RA; PITA_000041269-RA; PITA_000083680-RA; PITA_000026612-RA; PITA_000095545-RA; PITA_000044750-RA; PITA_000033148-RA; PITA_000023495-RA; PITA_000070583-RA; PITA_000070953-RA; PITA_000029141-RA; PITA_000040742-RA; PITA_000035464-RA; PITA_000057955-RA; PITA_000039726-RA; PITA_000086759-RA; PITA_000073053-RA; PITA_000041263-RA; PITA_000042661-RA; PITA_000047310-RA; PITA_000090596-RA; PITA_000018960-RA; PITA_000029639-RA; PITA_000056462-RA; PITA_000096134-RA; PITA_000056322-RA; PITA_000083164-RA; PITA_000060945-RA; PITA_000059566-RA; PITA_000066779-RA; PITA_000084783-RA; PITA_000041403-RA; PITA_000059122-RA; PITA_000056461-RA; PITA_000039202-RA; PITA_000057016-RA; PITA_000079496-RA; PITA_000026610-RA; PITA_000039203-RA; PITA_000065344-RA; PITA_000033149-RA; PITA_000070952-RA; PITA_000024380-RA; PITA_000012864-RA; PITA_000040705-RA; PITA_000000400-RA; PITA_000040704-RA; PITA_000056460-RA; PITA_000007334-RA; PITA_000022730-RA; PITA_000085087-RA; PITA_000013412-RA;
Populus trichocarpaPotri.015G041300; Potri.008G094200; Potri.010G159900; Potri.004G040700; Potri.001G409900; Potri.001G227300; Potri.004G019300; Potri.005G059500; Potri.004G019500; Potri.004G019700; Potri.T018600; Potri.001G227200; Potri.001G223300; Potri.001G222900; Potri.001G223400; Potri.019G010800; Potri.T018000; Potri.001G222800; Potri.004G019800; Potri.001G226100; Potri.001G225900; Potri.001G224000; Potri.001G223800; Potri.001G223500; Potri.001G223700; Potri.001G223600; Potri.002G219600; Potri.001G223900; Potri.001G226000; Potri.001G226200; Potri.001G227400; Potri.001G015100; Potri.004G109200; Potri.003G211100; Potri.001G403900; Potri.012G049300; Potri.004G019400; Potri.T019200; Potri.004G110200; Potri.010G178800; Potri.T177800; Potri.001G223200; Potri.001G227500; Potri.011G130200; Potri.001G227600; Potri.005G059100; Potri.003G020900;
Selaginella moellendorffiiSM00000G04310; SM00088G00130; SM00000G04250; SM00001G08630; SM00009G04040; SM00020G04280; SM00001G08620; SM00000G09280; SM00008G00840; SM00000G09300; SM00088G00290; SM00042G01830; SM00042G01760; SM00051G01890;
Vitis viniferaVV13G07270; VV17G06890; VV14G07160; VV01G10200; VV01G10210; VV06G06670; VV19G04630; VV13G08210; VV13G07250; VV13G07200; VV13G07100; VV13G07080; VV13G07160; VV13G07070; VV10G00470; VV06G06660; VV19G03390; VV19G03380; VV07G08330; VV07G08310; VV07G08280; VV13G07170; VV00G08400; VV13G07110; VV13G07210; VV13G08160; VV07G08290; VV07G08300; VV00G08390; VV13G07240; VV13G07190; VV13G07090; VV13G07120; VV13G07130; VV13G07180; VV13G07230; VV13G07140; VV13G07260; VV17G07760; VV15G09540;
Zea maysZM07G29120; ZM08G02070; ZM01G49940; ZM01G49920; ZM01G49930; ZM05G14000; ZM01G07830; ZM05G13340; ZM06G22010; ZM10G20210; ZM02G10220; ZM07G19080; ZM09G26050; ZM03G14220; ZM03G18560; ZM10G12890; ZM03G18570; ZM03G14210; ZM10G05970; ZM09G10270; ZM02G12470; ZM10G20190; ZM03G24150; ZM02G10190; ZM08G30010; ZM03G28870; ZM02G10210; ZM10G06230; ZM10G05920; ZM10G20200;

Map Image: 


Login | © 2019 PlantGenIE.org.| All our tools are under MIT License

  • GeneList
      view active genelist () here.
      genelist namegenesrename/delete
      add new genelist / save current list / cancel
  • Analysis
  • <