00       00

Click here to search
Bug Report
Report an error

P.abies 1.0 gene MA_619289g0010
Page views 529


Chromosome Start End Confidence Trinity id Subject length Subject coverage Subject strand Query strand
Loading data from server


Gene Description based on Blast2GO: G-type lectin S-receptor-like serine threonine- kinase SD2-5

Populus Transcript name:     Potri.006G254600.1
Arabidopsis id:     AT4G32300.1

Map Image: 


GO ID Name Space Description
GO:0005488molecular_functionbinding
GO:0016310biological_processphosphorylation
GO:0016301molecular_functionkinase activity

PFAM ID Description
PF00024PAN domain
PF00069Protein kinase domain
PF00954S-locus glycoprotein family
PF01453D-mannose binding lectin
PF07714Protein tyrosine kinase
PF08276PAN-like domain
PF08277PAN-like domain

CDS Sequence
Legend:   CDS        START                         

>MA_619289g0010[2570 nucleotides] 
ATGGAGTCCCCCGATGCTATGTGCACTTTGATTTTCCTGTGTTTGATCTGGGCAAGTGAAGGGAAGTTCTTTGCACTGCCTTCCAATTGGAAAGTGGCGATCAATAACACCAGCCTCCCGAGGCACAGCACGGTGCAGGGGCCCTTCAGAGCGGTCACAGACGGAAATGCGAACGCCATTGTTAGCGAGAATAACCGAGCCGGACTTGGATTCATTGACGTCAATTCTTCTGGCAAATTCGTTCTGTCTGTTGTCTTGGGATTGAATCTCACCACGCTTCCTGCAATGGAGATTTGGACTGCAAACAGGAACAGGATGGTAGCAGAGGACGCGACGCTCAGGCTGCGGGGTAATGGCGACCTGGTACTCGAAGACTCGGACGGAACCGTGGCCTGGAATATCAGTACCGGTAAACCTAAAGGCATTTTAATGGCGAAGAACGGTAATTTGCAGATATATAATACCACGAATTCTTCGCTTGCGTCCGCTGGTTCGAATCTCGTCTGGCAGAGCTGGGATCATCCGACGCATACGCTCGTGCCCGGGCAGGTGCTGAAGAGGGGGCAGGCACTTGTTTCCAATTCATCTGCGACGAATACAAGCGCTGGATCCTATAAGCTCGTTATGGAATGGGGAGGGCTAGTGTTGTTCTACACGAGCTCAACCCAGGAGCCTTATTGGTCTCTGGGTCTGCCCGGGCTGGACTACGAGAGCATTCTCAGGCCGTGCCTTTATAATTCTTCGCCTCTCGGCTCTGAGGCCGTCTATACGGGCCAGAATTTGCAGGTTTCGTTCAATGGAACGATTGATAATTTGTCTTCTTCTGCTTGCGCTAATGGGAATCGATTGCTGCCAATGGCTCCTTTTTACAATGACAACGAGCACAGGTTCCTGAGACTGGACAGCGATGGCAGCCTTCGCGTTTACAGGGTCGCTCCGGTGCCGGGACTGAACAATGTCACAAACTGGAGCACGGACTGGGAACTGGACCAATCTAATAAGAATTGCATACTTCCCAGAGCCTGCGGGCCTTATGGCATCTGTGCCAACGGTCAATGCAGTTGCCCCGGCTACGGAACGCGCGATCAATTCGAGCAAATCCAGAACCTGGACGTGACGCAGGGATGTTATAGCAGCCCGGGCGAGCCGTCGTGCAGCCAGCCGTCGGCGACAAACCATTTCATGCTCCTCGATGGTGTGGATTACTATCCCAACGACTACCTGAAGCCTGAAGAGAACGTCTCGACGGTCGAAAAATGCACTAGCCTCTGCACGTCTAATTGCTCCTGCACCGCCGCCTTCTTTCGCAGCAGTTCGACATCGTGTTACCTCGAGGACGGCCCGCTGTCGAGCCTGAAATCGGCGCCGAACCAGAACCAGACATACAAGGCCTACATAAAGGTCCTCAATAAGTTTCCTCGTAACGGGACCTCGGGGTCTAGTAATTCCCTGAGCATTGGCAGCATCGCCGGGATCACGTTGAGCTCGGCGGCCGCGGCTCTGTTCCTCTGCCTGATAACGATCATAGTCGTGAGAAGGAGCCGAACAAAAGAGTCGGTGATAGACGAAGCAGAGATCGATCCGGAGGAAATGGAGGAGGAAGCCTTCTTGAAGACGCTCCCGGGGCTTCCGCCGAGGTTCACGTATCACGAGCTCAAGGAAGCCACTGATAACTTCAGCAGAAAGCTCGGGACGGGAGGATTCGGATCTGTGTACGAAGGCGTTTTGAAGGACAAAACCGGAGTTGCCGTTAAGAAGCTGGACGGACCGAAACAGGGTTACAAGGAATTCAGAGCCGAAGTAGCGACGATCGGTAGCATAAGCCACGTGAATCTGGTGAGACTCCGGGGCTTCTGCGCCTATGCCCGCCAGAGGCTCCTGGTTTACGAGCTCATGGACAACTGTTCTCTGGATAAATGGCTATTCTCGCCTCCGGATCACGGCGGCGGCGGAAGAAGCAAAGGATGTTTAACGTGGGAACAGCGCTACAATGTGGCAGTGGGGACTGCCCGGGGCCTGGCCTACCTGCATGAGCAGTGCAGAGAACCTATTATGCACTTAGATATAAAGCCTCAGAACATCCTGCTCGACAAAAAATTTAATCCCAAGGTCTCCGACTTTGGCATGTCAAAATTCCTGAATGACGACATGACGCAGGTCGTGACGGCGGTACGAGGGACGCCCGGGTACCTGGCGCCCGAGTGGCTTCGGCACTCCATCGCCACCAAGAAATGCGATGTCTACAGCTTCGGGATGGTGTTGCTGGAGTTGGTGTCCGGGCGGAAGAACTTCGAGCCCTCTGCAGCCGATCCTCGGCTCTGTTATTTCCCGGCCTGGGCCATGCTGAGGGCTCTGGAGGGAAAGTACATGGATTTGGTTGATAAGAGGCTCGGGGATAACAGCGTGGACACAGAGAGTGTAACGAGGATGACCAAGGTTGCCTTCTGGTGTATTCAGGATAACCCCAACCAGAGGCCATGGATGAGCGTTGCCCTGAAGATGTTGGAGGGAGATTGGGATGTTCCGGATGCGCCAATGTGGCTGTTGCAGAGAGGGCCCGAAGATCGGAA
   



Genomic Sequence (+ strand)     upstream:    downstream:   
Legend:   CDS                         

>MA_619289:4642-7211[2570 nucleotides] 
ATGGAGTCCCCCGATGCTATGTGCACTTTGATTTTCCTGTGTTTGATCTGGGCAAGTGAAGGGAAGTTCTTTGCACTGCCTTCCAATTGGAAAGTGGCGATCAATAACACCAGCCTCCCGAGGCACAGCACGGTGCAGGGGCCCTTCAGAGCGGTCACAGACGGAAATGCGAACGCCATTGTTAGCGAGAATAACCGAGCCGGACTTGGATTCATTGACGTCAATTCTTCTGGCAAATTCGTTCTGTCTGTTGTCTTGGGATTGAATCTCACCACGCTTCCTGCAATGGAGATTTGGACTGCAAACAGGAACAGGATGGTAGCAGAGGACGCGACGCTCAGGCTGCGGGGTAATGGCGACCTGGTACTCGAAGACTCGGACGGAACCGTGGCCTGGAATATCAGTACCGGTAAACCTAAAGGCATTTTAATGGCGAAGAACGGTAATTTGCAGATATATAATACCACGAATTCTTCGCTTGCGTCCGCTGGTTCGAATCTCGTCTGGCAGAGCTGGGATCATCCGACGCATACGCTCGTGCCCGGGCAGGTGCTGAAGAGGGGGCAGGCACTTGTTTCCAATTCATCTGCGACGAATACAAGCGCTGGATCCTATAAGCTCGTTATGGAATGGGGAGGGCTAGTGTTGTTCTACACGAGCTCAACCCAGGAGCCTTATTGGTCTCTGGGTCTGCCCGGGCTGGACTACGAGAGCATTCTCAGGCCGTGCCTTTATAATTCTTCGCCTCTCGGCTCTGAGGCCGTCTATACGGGCCAGAATTTGCAGGTTTCGTTCAATGGAACGATTGATAATTTGTCTTCTTCTGCTTGCGCTAATGGGAATCGATTGCTGCCAATGGCTCCTTTTTACAATGACAACGAGCACAGGTTCCTGAGACTGGACAGCGATGGCAGCCTTCGCGTTTACAGGGTCGCTCCGGTGCCGGGACTGAACAATGTCACAAACTGGAGCACGGACTGGGAACTGGACCAATCTAATAAGAATTGCATACTTCCCAGAGCCTGCGGGCCTTATGGCATCTGTGCCAACGGTCAATGCAGTTGCCCCGGCTACGGAACGCGCGATCAATTCGAGCAAATCCAGAACCTGGACGTGACGCAGGGATGTTATAGCAGCCCGGGCGAGCCGTCGTGCAGCCAGCCGTCGGCGACAAACCATTTCATGCTCCTCGATGGTGTGGATTACTATCCCAACGACTACCTGAAGCCTGAAGAGAACGTCTCGACGGTCGAAAAATGCACTAGCCTCTGCACGTCTAATTGCTCCTGCACCGCCGCCTTCTTTCGCAGCAGTTCGACATCGTGTTACCTCGAGGACGGCCCGCTGTCGAGCCTGAAATCGGCGCCGAACCAGAACCAGACATACAAGGCCTACATAAAGGTCCTCAATAAGTTTCCTCGTAACGGGACCTCGGGGTCTAGTAATTCCCTGAGCATTGGCAGCATCGCCGGGATCACGTTGAGCTCGGCGGCCGCGGCTCTGTTCCTCTGCCTGATAACGATCATAGTCGTGAGAAGGAGCCGAACAAAAGAGTCGGTGATAGACGAAGCAGAGATCGATCCGGAGGAAATGGAGGAGGAAGCCTTCTTGAAGACGCTCCCGGGGCTTCCGCCGAGGTTCACGTATCACGAGCTCAAGGAAGCCACTGATAACTTCAGCAGAAAGCTCGGGACGGGAGGATTCGGATCTGTGTACGAAGGCGTTTTGAAGGACAAAACCGGAGTTGCCGTTAAGAAGCTGGACGGACCGAAACAGGGTTACAAGGAATTCAGAGCCGAAGTAGCGACGATCGGTAGCATAAGCCACGTGAATCTGGTGAGACTCCGGGGCTTCTGCGCCTATGCCCGCCAGAGGCTCCTGGTTTACGAGCTCATGGACAACTGTTCTCTGGATAAATGGCTATTCTCGCCTCCGGATCACGGCGGCGGCGGAAGAAGCAAAGGATGTTTAACGTGGGAACAGCGCTACAATGTGGCAGTGGGGACTGCCCGGGGCCTGGCCTACCTGCATGAGCAGTGCAGAGAACCTATTATGCACTTAGATATAAAGCCTCAGAACATCCTGCTCGACAAAAAATTTAATCCCAAGGTCTCCGACTTTGGCATGTCAAAATTCCTGAATGACGACATGACGCAGGTCGTGACGGCGGTACGAGGGACGCCCGGGTACCTGGCGCCCGAGTGGCTTCGGCACTCCATCGCCACCAAGAAATGCGATGTCTACAGCTTCGGGATGGTGTTGCTGGAGTTGGTGTCCGGGCGGAAGAACTTCGAGCCCTCTGCAGCCGATCCTCGGCTCTGTTATTTCCCGGCCTGGGCCATGCTGAGGGCTCTGGAGGGAAAGTACATGGATTTGGTTGATAAGAGGCTCGGGGATAACAGCGTGGACACAGAGAGTGTAACGAGGATGACCAAGGTTGCCTTCTGGTGTATTCAGGATAACCCCAACCAGAGGCCATGGATGAGCGTTGCCCTGAAGATGTTGGAGGGAGATTGGGATGTTCCGGATGCGCCAATGTGGCTGTTGCAGAGAGGGCCCGAAGATCGGAA
   



Peptide Sequence
>MA_619289p0010[856 residues] 
MESPDAMCTLIFLCLIWASEGKFFALPSNWKVAINNTSLPRHSTVQGPFRAVTDGNANAIVSENNRAGLGFIDVNSSGKFVLSVVLGLNLTTLPAMEIWTANRNRMVAEDATLRLRGNGDLVLEDSDGTVAWNISTGKPKGILMAKNGNLQIYNTTNSSLASAGSNLVWQSWDHPTHTLVPGQVLKRGQALVSNSSATNTSAGSYKLVMEWGGLVLFYTSSTQEPYWSLGLPGLDYESILRPCLYNSSPLGSEAVYTGQNLQVSFNGTIDNLSSSACANGNRLLPMAPFYNDNEHRFLRLDSDGSLRVYRVAPVPGLNNVTNWSTDWELDQSNKNCILPRACGPYGICANGQCSCPGYGTRDQFEQIQNLDVTQGCYSSPGEPSCSQPSATNHFMLLDGVDYYPNDYLKPEENVSTVEKCTSLCTSNCSCTAAFFRSSSTSCYLEDGPLSSLKSAPNQNQTYKAYIKVLNKFPRNGTSGSSNSLSIGSIAGITLSSAAAALFLCLITIIVVRRSRTKESVIDEAEIDPEEMEEEAFLKTLPGLPPRFTYHELKEATDNFSRKLGTGGFGSVYEGVLKDKTGVAVKKLDGPKQGYKEFRAEVATIGSISHVNLVRLRGFCAYARQRLLVYELMDNCSLDKWLFSPPDHGGGGRSKGCLTWEQRYNVAVGTARGLAYLHEQCREPIMHLDIKPQNILLDKKFNPKVSDFGMSKFLNDDMTQVVTAVRGTPGYLAPEWLRHSIATKKCDVYSFGMVLLELVSGRKNFEPSAADPRLCYFPAWAMLRALEGKYMDLVDKRLGDNSVDTESVTRMTKVAFWCIQDNPNQRPWMSVALKMLEGDWDVPDAPMWLLQRGPEDR
   



PlantGenIE GeneLists

Gene Family Genes
Amborella trichopodascaffold00072.15; scaffold00072.16; scaffold00024.108; scaffold00078.12; scaffold00024.107; scaffold00002.617; scaffold00138.18; scaffold00006.103; scaffold00030.66; scaffold00030.53; scaffold00002.472; scaffold00009.133; scaffold00075.7; scaffold00042.44; scaffold00002.471; scaffold00008.10; scaffold00022.223; scaffold00002.470; scaffold00072.13; scaffold00024.109; scaffold00037.4; scaffold00010.264; scaffold00022.212; scaffold00019.300;
Arabidopsis thalianaAT2G19130; AT4G32300; AT5G35370; AT5G20050; AT5G24080; AT5G60900; AT4G00340;
Oryza sativa ssp. japonicaOS06G06930; OS06G06920; OS04G34320; OS04G34290; OS01G65060; OS07G08860; OS04G42740; OS06G29810; OS01G12290; OS01G65010; OS05G07450; OS07G36780; OS01G66680; OS01G66640; OS05G07300; OS01G45520; OS10G20120; OS04G34270; OS04G01310; OS01G12400; OS04G34330; OS05G07420; OS04G01320; OS04G34390; OS01G12410; OS10G20160; OS01G06240; OS04G34250; OS04G28780; OS03G61310; OS05G34390; OS04G34420; OS08G13870; OS04G34370; OS01G12420; OS01G66630; OS04G34360; OS01G12430; OS08G13420; OS01G02310; OS01G66610; OS03G12150; OS06G05070; OS01G46030; OS02G52850; OS09G28180; OS04G34410; OS12G44320; OS10G03990; OS01G65030; OS11G10280; OS05G07470; OS06G35870; OS05G07080; OS04G34300; OS04G07200; OS11G10290; OS02G13410; OS11G12270; OS01G65040; OS05G16320; OS01G73370;
Physcomitrella patensPP00315G00290; PP00180G00280; PP00004G00430; PP00373G00270; PP00112G00640; PP00019G01380;
Picea abiesMA_10433473g0010; MA_8688687g0010; MA_121826g0010; MA_10429053g0020; MA_10436159g0020; MA_17294g0010; MA_331881g0020; MA_10435726g0020; MA_10348777g0010; MA_180535g0010; MA_10436840g0020; MA_120873g0010; MA_202506g0010; MA_10235107g0010; MA_10426231g0030; MA_10436602g0020; MA_46385g0010; MA_103711g0020; MA_5708g0010; MA_10435726g0030; MA_10433174g0010; MA_293807g0010; MA_619289g0010; MA_6389448g0010; MA_8370g0020; MA_715560g0010; MA_19963g0010; MA_119807g0010; MA_10429078g0010; MA_60488g0020; MA_357447g0010; MA_9232031g0010; MA_503135g0010; MA_10426598g0020; MA_470235g0010; MA_139996g0010; MA_45744g0020; MA_103711g0010; MA_70143g0020; MA_36555g0010; MA_10436602g0010; MA_10434385g0010; MA_10435726g0010; MA_10426598g0010; MA_346860g0010; MA_9793769g0010; MA_10427360g0030; MA_10433174g0020; MA_10259799g0010; MA_18477g0010; MA_10433215g0010; MA_6657517g0010; MA_272217g0010; MA_218523g0010; MA_10348777g0020; MA_9724058g0010; MA_577114g0010; MA_9101793g0010; MA_10426231g0020; MA_7948721g0010; MA_33934g0020; MA_27553g0010; MA_10429013g0010; MA_4603066g0010; MA_4721176g0010; MA_10433215g0020; MA_10426231g0040; MA_8842478g0010; MA_94182g0010; MA_9896021g0010; MA_814039g0010; MA_432075g0010; MA_190752g0010; MA_4421g0010; MA_503581g0010; MA_10431336g0010; MA_10436840g0010; MA_456565g0010; MA_3528435g0010; MA_10427360g0050; MA_10434254g0030; MA_889873g0020; MA_10429053g0030; MA_8375289g0010; MA_161225g0020; MA_3533415g0010; MA_12965g0020; MA_7653648g0010; MA_496519g0010; MA_10294952g0010; MA_4772613g0010; MA_130462g0010; MA_176379g0010; MA_9766061g0010;
Pinus taedaPITA_000090448-RA; PITA_000062685-RA; PITA_000051041-RA; PITA_000019219-RA; PITA_000083646-RA; PITA_000056499-RA; PITA_000036044-RA; PITA_000062578-RA; PITA_000043800-RA; PITA_000051304-RA; PITA_000051143-RA; PITA_000071550-RA; PITA_000081888-RA; PITA_000057329-RA; PITA_000014366-RA; PITA_000041604-RA; PITA_000046535-RA; PITA_000019218-RA; PITA_000039175-RA; PITA_000044347-RA; PITA_000089574-RA; PITA_000078449-RA; PITA_000076702-RA; PITA_000023603-RA; PITA_000001493-RA; PITA_000047070-RA; PITA_000047068-RA; PITA_000071888-RA; PITA_000019217-RA; PITA_000042338-RA; PITA_000086019-RA; PITA_000052961-RA; PITA_000059584-RA; PITA_000056629-RA; PITA_000062846-RA; PITA_000072058-RA; PITA_000081782-RA; PITA_000087917-RA; PITA_000026230-RA; PITA_000082656-RA; PITA_000062870-RA; PITA_000053926-RA; PITA_000091048-RA; PITA_000090087-RA; PITA_000000645-RA; PITA_000063046-RA; PITA_000000455-RA; PITA_000093711-RA; PITA_000046502-RA; PITA_000049113-RA; PITA_000093181-RA; PITA_000088171-RA; PITA_000032292-RA; PITA_000070977-RA; PITA_000078706-RA; PITA_000081402-RA; PITA_000003064-RA; PITA_000096524-RA; PITA_000077140-RA; PITA_000016493-RA; PITA_000023602-RA; PITA_000083872-RA; PITA_000066441-RA; PITA_000070910-RA; PITA_000085338-RA; PITA_000095796-RA; PITA_000095312-RA; PITA_000088992-RA; PITA_000044348-RA; PITA_000046505-RA; PITA_000053925-RA; PITA_000087915-RA; PITA_000093431-RA; PITA_000096568-RA; PITA_000067344-RA; PITA_000092021-RA; PITA_000061037-RA; PITA_000055646-RA; PITA_000061707-RA; PITA_000071043-RA; PITA_000075365-RA; PITA_000090686-RA; PITA_000093740-RA; PITA_000078708-RA; PITA_000082782-RA; PITA_000095485-RA; PITA_000087391-RA; PITA_000055087-RA; PITA_000011368-RA; PITA_000053837-RA; PITA_000080729-RA; PITA_000030441-RA; PITA_000075364-RA; PITA_000037389-RA; PITA_000033035-RA; PITA_000094680-RA; PITA_000079507-RA; PITA_000046503-RA; PITA_000082767-RA; PITA_000067552-RA; PITA_000090386-RA; PITA_000090472-RA; PITA_000082780-RA; PITA_000018608-RA; PITA_000003059-RA; PITA_000093741-RA; PITA_000082781-RA; PITA_000096519-RA; PITA_000084390-RA; PITA_000082768-RA; PITA_000048420-RA; PITA_000020499-RA; PITA_000093742-RA; PITA_000062546-RA; PITA_000071415-RA; PITA_000056613-RA; PITA_000067210-RA; PITA_000066182-RA; PITA_000073030-RA; PITA_000070097-RA; PITA_000091240-RA; PITA_000046500-RA; PITA_000068463-RA; PITA_000078150-RA; PITA_000089928-RA; PITA_000020608-RA; PITA_000051399-RA; PITA_000088173-RA; PITA_000051396-RA; PITA_000095130-RA; PITA_000093388-RA; PITA_000092921-RA; PITA_000057600-RA; PITA_000018147-RA; PITA_000041605-RA; PITA_000041606-RA; PITA_000003618-RA; PITA_000062985-RA; PITA_000050876-RA; PITA_000016071-RA; PITA_000096520-RA; PITA_000017126-RA; PITA_000096448-RA; PITA_000077139-RA; PITA_000065911-RA; PITA_000094678-RA; PITA_000093712-RA; PITA_000056198-RA; PITA_000078705-RA; PITA_000061630-RA; PITA_000095389-RA; PITA_000027080-RA; PITA_000088172-RA; PITA_000062577-RA; PITA_000078707-RA; PITA_000082438-RA; PITA_000031340-RA; PITA_000043864-RA; PITA_000057379-RA; PITA_000007353-RA; PITA_000075053-RA; PITA_000050406-RA; PITA_000093248-RA; PITA_000009983-RA; PITA_000053838-RA; PITA_000081869-RA; PITA_000062956-RA; PITA_000064557-RA; PITA_000018992-RA; PITA_000071044-RA; PITA_000039610-RA; PITA_000028550-RA; PITA_000072175-RA; PITA_000052619-RA; PITA_000092403-RA; PITA_000083546-RA; PITA_000069458-RA; PITA_000054079-RA; PITA_000030153-RA; PITA_000091850-RA; PITA_000040173-RA; PITA_000013717-RA; PITA_000031339-RA; PITA_000080431-RA; PITA_000073200-RA; PITA_000051397-RA; PITA_000076276-RA; PITA_000047264-RA; PITA_000071045-RA; PITA_000003619-RA; PITA_000091241-RA; PITA_000073620-RA; PITA_000052858-RA; PITA_000014372-RA; PITA_000065465-RA; PITA_000089929-RA; PITA_000053382-RA; PITA_000003620-RA;
Populus trichocarpaPotri.010G103300; Potri.002G086500; Potri.013G149500; Potri.013G121000; Potri.019G119200; Potri.T003400; Potri.006G254600; Potri.018G027300; Potri.014G086900; Potri.019G007600; Potri.007G111200; Potri.013G059900; Potri.004G061900; Potri.007G110900; Potri.T084400; Potri.018G070800; Potri.012G131600; Potri.005G056700; Potri.005G056800; Potri.001G228200; Potri.013G060000; Potri.015G026300; Potri.T084600; Potri.012G034900; Potri.004G139400; Potri.019G011900; Potri.008G000500; Potri.008G000700; Potri.T158500; Potri.013G121500;
Selaginella moellendorffiiSM00001G00110; SM00001G00120; SM00030G01200; SM00070G01760; SM00021G03160; SM00033G01920; SM00062G00020; SM00010G02910; SM00024G01370; SM00017G01480; SM00004G03580; SM00043G01580; SM00030G01280; SM00011G05500; SM00010G02940; SM00014G00970; SM00020G02370; SM00006G05700; SM00064G00450; SM00020G02420; SM00154G00570; SM00062G00040; SM00046G00910; SM00154G00620; SM00002G02390; SM00006G04770; SM00006G04030; SM00001G00480; SM00029G03340; SM00095G00630; SM00006G04690; SM00006G04680; SM00006G05650; SM00002G01320; SM00084G00200; SM00197G00040; SM00024G01630; SM00002G04550; SM00091G01140; SM00033G01860; SM00064G00470; SM00064G00460; SM00129G00050; SM00084G01210; SM00004G05190; SM00002G04530; SM00030G01190; SM00064G00480; SM00006G05660; SM00006G04700; SM00029G03300; SM00064G00510; SM00095G00620; SM00002G03130;
Vitis viniferaVV18G06530; VV18G06520; VV09G06930; VV19G02840; VV05G04690; VV01G05560; VV04G05460; VV04G05500; VV11G06050; VV16G07370; VV16G07350; VV18G00480; VV12G00340; VV12G01660; VV12G01670; VV04G12180; VV16G07340; VV16G07310; VV10G07730; VV16G07330; VV16G07300;
Zea maysZM01G31950; ZM09G09300; ZM06G04540; ZM07G23970; ZM01G31800; ZM08G30160; ZM10G16420; ZM10G02640; ZM10G16400; ZM01G32100; ZM03G04580; ZM08G06110; ZM01G08240; ZM01G35060; ZM07G21830; ZM05G41610; ZM05G41540; ZM02G36150; ZM04G34390; ZM04G34010; ZM02G15590; ZM09G05050; ZM10G16490; ZM10G16460; ZM10G16450; ZM01G30790; ZM02G46100; ZM07G15900; ZM10G05800; ZM06G04520; ZM03G00870; ZM10G16440; ZM10G02530;

Map Image: 


Login | © 2019 PlantGenIE.org.| All our tools are under MIT License

  • GeneList
      view active genelist () here.
      genelist namegenesrename/delete
      add new genelist / save current list / cancel
  • Analysis
  • <