00       00

Click here to search
Bug Report
Report an error

P.abies 1.0 gene MA_52027g0010
Page views 88


Chromosome Start End Confidence Trinity id Subject length Subject coverage Subject strand Query strand
Loading data from server


Gene Description based on Blast2GO: Squamosa promoter-binding 14

Populus Transcript name:     Potri.005G258700.1
Arabidopsis id:     AT1G20980.1

Map Image: 


Gene Ontology values could not be found for MA_52027g0010 gene.


PFAM ID Description
PF00023Ankyrin repeat
PF03110SBP domain
PF12796Ankyrin repeats (3 copies)
PF13606Ankyrin repeat
PF13637Ankyrin repeats (many copies)
PF13857Ankyrin repeats (many copies)

CDS Sequence
Legend:   CDS        START        STOP                         

>MA_52027g0010[3009 nucleotides] 
ATGGAAAACGAAGCAGGTCCTCGGGTTGCATACTTCTCCCATCCGTTTCCTCCGGGAGGATTTGCGCAGCAGAAACATGGCGGCACTTATAGACACCAAGCGCGTAATGCGGGTTGGAATGCTGACTCTTGGGAATGGGACAGCCTAAGGTTCGTGGCAAAGCCTGCCGATGAAAAGAGTCATGGCAGGGAGGGTTCTAACGTTCAGAATGCGGAGGCTTCTTCAAGGATTTTACATTTGGGAACCCATGATTCTACGAATATGCGGCCAGAAAACAATAAAAGGAAGTATTCATCGGAAGAAGAAGATGCAGGAAACCTTACATTGAAGCTAGGGGGAAGCTTATACGGGGATGACAGTAATTCAAAGACTAATAAACGTTTCAGATCTGGTTTCGTCTCGAGCTCATATCCACTGTGTCAGGTGGACGATTGTCGGATAGATCTTACCAATGCCAAGGACTACCACAGAAGGCACAAAGTATGTGAACCCCATTCCAAAGCTTCCACAGCCCTGGTTGGAACTGTTATGCAACGATTCTGCCAACAATGTAGCAGGTTCCATCCCCTTGGAGAATTTGATGAGGGAAAGAGGAGCTGCAGGCGAAGGCTAGCCGGGCATAACAAGCGAAGACGGAAAACACAAGCCGAAGAGATCGGTTGCAGAGGATTTATGACTGGAGATGAAAATGGAGCTTTGAGAAATTTCGACATTGCTAGCCTTGTTGCTGTATTGTCCCACCAACATCAAGCAAGCAATTCTGTGGACAAGTTGTTTGACCGGAGATCATTGGACAAAGAGCATCTCATAAGGTGCTTGAGTAAACTGAAATCTGTGCCTTCTTTGGGAGATATTGGCACAACTCGGCCTCAGCTGGCAATTGATTTAAACGTTTCACAAAATATGCAACCACAAGCTCAAGCGCAGGATGCCAAGGGCAAAGCTCTGCAGACAAATGATCGTCAGTCCCCTGTTCCGGACTCAGAAATGTTGAGGATTCTCTCAACTTTGACAGAACGCTCCCCTGAAGCCCTGAGTCTCCTGCAGAGAAGTCTTATGGCACAGAAGACTCTGAATTCACACAACTCTTATGATCAGCAAACGATCAGTCAACAGTTCCTGAACATAAGTCCAACCCTTATTGCATCTCGAGACATTGACCATGTAGCAATTTCTGATGGTCATGAGAATATTTCAAAAAATTCCCTCTCTAGAGGCAATCTTGCTTGGCCTGTGCATCATTTTAATTCTTCTGACGGCATGCACAATCCAAATCTTGTGGTCTCAAAACAGTATTTCAAAGAGGATAGCTGCAATCCCCTGGAAGAGCGGTTCTCTTCAAGGAGTCCATCTTTGTCACCACCTGTCGTACAGAAACTTTTCCCTTTGCATTCCAAAGATGAAAACAAAGAGATTGACAGTGTTTCAGTTTGCGAGGAAGATGAATTAACACCAGATCAAAGTCCTAAAGACGATGGGTTATGCAAATTCGGTCTCTCAAATAGTGGAAGGAGAAATGATCGGCACAACATCTCCTTAAGTTCTCCACCTGCAGCTTCAGATCTCAGGATCAATGGGTATACTTCTTCAGGGTCAGATCAGTCTCCAACAAGTTCCAATTCAGATACAAAAGAACGCACAAGCAGAATTATTTTCAAACTCTTTGGGAAAGACCCGAGCGATTTTCCCCAAACGCTGCGGACCCAGATTCTTGAATGGTTGTCTCACTGCCCATCAGACATGGAGAGCTACATAAGGCCTGGCTGTGTCATTCTCACGATATTTGCATCCATGCCAATGGCTGCATGGGAACAGGCATCTAAGAGGGGACTTGCAAGAACAGACGGCAAGATTCGGTTTTGCAGGTCTTCTAGTTCGTTGGATGCTCCAGAAATATGTTCAGTCTGGCCTATTGCAGTTGTGGCAGGTGAAGAAACTAGACTTGTTCTCAGAGGCCACAATTTGACTACTCCTGGTACAAAAATTCTATGTGCTTACAGGGGAAAGTACATCTCACAAAATGTTCCAGAAGATTATCAAGTAGGCAGTAGTGCTTTCTTCTCAAATGCCACTACTATTGAGCACAAATTCCCGGGGGGGCCGGCTAATGTCTTTGGTCGTTTTTTCATGGAGGTTGAGCGAGGTTTCAAGGGAAACAACTTTCCAGTTATTGTGGCAGACAGTGCGATATGTAGAGAGCTACGTACCCTAGAAGGTGAATTCGAAGGAATCTGTGAGGGCAAAGTAATAGATTGGCATTCAAAACCACATTCTCGAGAAGATGTCGTATTTGGTATCCAAGAAGATGTCGTCACTTTTTTAAATGAGTTGGGATGGCTTTTCCAAAGAAATTCTTACTTGAAGGAGGGGCTTTTTTCTCCAAAAGATGCACCTGCCCGGTTCAAGTTTCTTTTGACTTATGCTGTGGAAAGGAATTGGAATTCTTTACTTAAGAAGGTTCTGGATATACTTTTTATAATGTATGGTGAAGAAGAAGGATCAGTTCGAGAGGCATTCAGTATCTTGTCAGAAATTGACTTGCTGCACAGGGCAGTGAAGAGAAATTGCAGACAAGTTGTGGATATGCTTCTGTGCTATGTACCATCATCAAGTGCTGATAGAAACATTGCATTCAGACCAGATGTGATTGGTCCAGGGGGTCTTACGCCCCTGCATTTAGCTGCAAGTATGCAAAATGCAGAGGACGTTGTTGATGCTTTGACCAATGATCCACAAAAGATTGGATTGCAAGCTTGGACCACAGCCTTGGATGCAAACCAGCAGACACCACATGCCTATGCCTTGATGAGAAATAACCACACATATAACAGGTTGGTATTGGAAAAAATGGCAGATCAGAGAAGGGCTCAGGCAGGCCCTTGGAACCTTGATGTAACAGGTTTTCTGCCTGGAACCTTGCAAAACATCAAGGTTCCACCTGCATTTATAGCAAGTCTGTCTGGTGCTCAAGGTTTGCTGGAAATAGAGAAAAGGCCTAACCAGATCTAA
   



Genomic Sequence (- strand)     upstream:    downstream:   
Legend:   CDS                         

>MA_52027:6021-11523[5503 nucleotides] 
ATGGAAAACGAAGCAGGTCCTCGGGTTGCATACTTCTCCCATCCGTTTCCTCCGGGAGGATTTGCGCAGCAGAAACATGGCGGCACTTATAGACACCAAGCGCGTAATGCGGGTTGGAATGCTGACTCTTGGGAATGGGACAGCCTAAGGTTCGTGGCAAAGCCTGCCGATGAAAAGAGTCATGGCAGGGAGGGTTCTAACGTTCAGAATGCGGAGGCTTCTTCAAGGATTTTACATTTGGGAACCCATGATTCTACGAATATGCGGCCAGAAAACAATAAAAGGAAGTATTCATCGGAAGAAGAAGATGCAGGAAACCTTACATTGAAGCTAGGGGGAAGCTTATACGGGGATGACAGTAATTCAAAGACTAATAAACGTTTCAGATCTGGTTTCGTCTCGAGCTCATATCCACTGTGTCAGGTGGACGATTGTCGGATAGATCTTACCAATGCCAAGGACTACCACAGAAGGCACAAAGTATGTGAACCCCATTCCAAAGCTTCCACAGCCCTGGTTGGAACTGTTATGCAACGATTCTGCCAACAATGTAGCAGGTAAGTTGTAACGGCCTCTTTTATGTTTGCTGCAAGAACATGGCCACATAGAATGATGGATTGTTATTGGTTAAATCTTGAAGTAGTCGTGCTAATTATGAGATAAAATTCGGTCATAGATAAGCATTTTTCTGTCTGGGATTGGGGGAAGGAATTTGATGTCATCCTTTATGTTACAGGTTCCATCCCCTTGGAGAATTTGATGAGGGAAAGAGGAGCTGCAGGCGAAGGCTAGCCGGGCATAACAAGCGAAGACGGAAAACACAAGCCGAAGAGATCGGTTGCAGAGGATTTATGACTGGAGATGAAAATGGAGCTTTGAGAAATTTCGACATTGCTAGCCTTGTTGCTGTATTGTCCCACCAACATCAAGGTAAGGCCTGCTAGACTGAAATCTATGTTTCCTGCCGATTGGCGTGGTGAGAATTGTTTTCATTGTTATCCCGCAATCCATGTTTTCGTTGCTGATCGTTCTTCAATCTACTAAACTGACCGATCTTCGTTCCAGCAAGCAATTCTGTGGACAAGTTGTTTGACCGGAGATCATTGGACAAAGAGCATCTCATAAGGTGCTTGAGTAAACTGAAATCTGTGCCTTCTTTGGGAGATATTGGCACAACTCGGCCTCAGCTGGCAATTGATTTAAACGTTTCACAAAATATGCAACCACAAGCTCAAGCGCAGGATGCCAAGGGCAAAGCTCTGCAGACAAATGATCGTCAGTCCCCTGTTCCGGACTCAGAAATGTTGAGGATTCTCTCAACTTTGACAGAACGCTCCCCTGAAGCCCTGAGTCTCCTGCAGAGAAGTCTTATGGCACAGAAGACTCTGAATTCACACAACTCTTATGATCAGCAAACGATCAGTCAACAGTTCCTGAACATAAGTCCAACCCTTATTGCATCTCGAGACATTGACCATGTAGCAATTTCTGATGGTCATGAGAATATTTCAAAAAATTCCCTCTCTAGAGGCAATCTTGCTTGGCCTGTGCATCATTTTAATTCTTCTGACGGCATGCACAATCCAAATCTTGTGGTCTCAAAACAGTATTTCAAAGAGGATAGCTGCAATCCCCTGGAAGAGCGGTTCTCTTCAAGGAGTCCATCTTTGTCACCACCTGTCGTACAGAAACTTTTCCCTTTGCATTCCAAAGATGAAAACAAAGAGATTGACAGTGTTTCAGTTTGCGAGGAAGATGAATTAACACCAGATCAAAGTCCTAAAGACGATGGGTTATGCAAATTCGGTCTCTCAAATAGTGGAAGGAGAAATGATCGGCACAACATCTCCTTAAGTTCTCCACCTGCAGCTTCAGATCTCAGGATCAATGGGTATACTTCTTCAGGGTCAGATCAGTCTCCAACAAGTTCCAATTCAGATACAAAAGTATGTGATATGTTGTTTTTCCTCCTCCCGTTATCTCTGTGGATGGATATCGATATAGAGGGGTTGGATATGTGTAATAGGATTTCTCTCACTATTGAAATTTTCAGGAACGCACAAGCAGAATTATTTTCAAACTCTTTGGGAAAGACCCGAGCGATTTTCCCCAAACGCTGCGGACCCAGGTGAGATCCATGCGATGATTAAAATTTTTGGTAAAAAAATACTTTGTATGTGAAGTAGATTTTCATAAGTAATCTGTTTATATTTTCTGAAGCCTGGACCATAACACGCTTGTGTCTTTGTAGATTCTTGAATGGTTGTCTCACTGCCCATCAGACATGGAGAGCTACATAAGGCCTGGCTGTGTCATTCTCACGATATTTGCATCCATGCCAATGGCTGCATGGGAACAGGCATGTGCGTTATCAGAAATATTTGATGTGATTGAAAACCTTTATTCTGTATTCAGGGTTTGTTGAAAAGGCTGTATTGATATCAATATTCATGTCCTGCAGCTAAGAGGGGACTTGCAAGAACGTATGAAATTACTACTTTTTAAGAATAACGATTTTTGGAAGAATGGTCGTATAATAGTTCAAGCTGAACAGCAATTAGCTTTATTCAGAGACGGTAATTACCTGATTTTCTTTTCAGAGGGATAATGTTTTGCAGTTTCTAAGCCTTTCGACATTCTAGATTCTTTGTACAGTAACATGCCTTATTTCTACTTTTCCATTTCGCTGCAGGCAAGATTCGGTTTTGCAGGTCTTCTAGTTCGTTGGATGCTCCAGAAATATGTTCAGTCTGGCCTATTGCAGTTGTGGCAGGTGAAGAAACTAGACTTGTTCTCAGAGGCCACAATTTGACTACTCCTGGTACAAAGTAAGTTTGTGTGTAAATCGTTTATTAGACAGATCTAGTCCAGAGTTGATTAGCAGGAATAGATAGGTTTGAAGTCGATAGTCGGTGAAGAAACTAGACTTGTTCTCAGAGGCCACAATTTGACAACTCCTGGTACAAAATAAGTTTGTGTAAATTGTTTTCTAGACAGACTAGTCCAAAATTGATTAGCAGGAATAGATAGGTTTGAATGAATTTTTCTTTTAGAAAAATGCTTCCTATATTAAATAGGAACAAAAAATACAATAAATAAACGATATTCAGGTTTTAATCAAATCTTATATTCCTAGAAATATTGGATGCAGAATTCTATGTGCTTACAGGGGAAAGTACATCTCACAAAATGTTCCAGAAGATTATCAAGTAGGCAGTAGTGCTTTCTTCTCAAATGCCACTACTATTGAGCACAAATTCCCGGGGGGGCCGGCTAATGTCTTTGGTCGTTTTTTCATGGAGGTGGGTTTTTAATAAGATCTTCCATGTGCTTCGCCTGATATTTGAAATCATTTTATTTTTATTGAAGTTGTTCCCTTCTGGTTCTTACCCTTATACAACTCTGGATTGAAATAATATGCAGGTTGAGCGAGGTTTCAAGGGAAACAACTTTCCAGTTATTGTGGCAGACAGTGCGATATGTAGAGAGCTACGTACCCTAGAAGGTGAATTCGAAGGAATCTGTGAGGGCAAAGTAATAGATTGGCATTCAAAACCACATTCTCGAGAAGATGTCGTATTTGGTATCCAAGAAGATGTCGTCACTTTTTTAAATGAGTTGGGATGGCTTTTCCAAAGAAATTCTTACTTGAAGGAGGGGCTTTTTTCTCCAAAAGATGCACCTGCCCGGTTCAAGTTTCTTTTGACTTATGCTGTGGAAAGGAATTGGAATTCTTTACTTAAGAAGGTTCTGGATATACTTTTTATAATGTATGGTGAAGAAGAAGGATCAGTTCGAGAGGCATTCAGTATCTTGTCAGAAATTGACTTGCTGCACAGGGCAGTGAAGAGAAATTGCAGACAAGTTGTGGATATGCTTCTGTGCTATGTACCATCATCAAGTGCTGATAGAAACATTGCATTCAGACCAGATGTGATTGGTCCAGGGGGTCTTACGCCCCTGCATTTAGCTGCAAGTATGCAAAATGCAGAGGACGTTGTTGATGCTTTGACCAATGATCCACAAAAGGTGAGAAAATAGAATACATGCTTTGATTGGCTGAACAAGTATGGCCTTTACATGACAATTGCCTCAATTTTTGACATAATCCTTGTCTTTCTGCAGATTGGATTGCAAGCTTGGACCACAGCCTTGGATGCAAACCAGCAGACACCACATGCCTATGCCTTGATGAGAAATAACCACACATATAACAGGTTGGTATTGGAAAAAATGGCAGATCAGAGAAGGGCTCAGGTATCAATAACAATCTCAAAAGAACTATCTTTTAACAAGACTGCAATGCAAGGTGCTGACGGAACAGTAGGTTTAAATATAGAGTTGTCTCAGGTTACATTGCAGAATCTTCCCTCAAGTTGTTCCAAATGCATGAGACTCAGGTCCAACAGGGTATCAAGGCTGGCCGGCTATCATGGTTCACTGTATCGTCCATTTATTCATTCCTTGCTTGCCACTGCAGCAGTTTGTGTTTGTGTATGCTTGCTGTTCAAGACACTCCCCACAATTGGTTCAGTTGCACCGTTCATGTGGGAAAAAATTCATTATGGTAGCGACTGAAGTTGTTTAATTATATATATCTTTGGGGTATCTTGCCTCATCCCATGGGAAAGTTGGTTCCCCTAGGGAATGGTCTGTTATCCCAAGTGACTAGGATGATATTGTTCAGAGTGTTACTGTTACTGCTGACCTGCCAAGAAATGTTTCTACATCACTGTGCATATTTGAATGGATTGTAATGTTTAGTTTGTAATGGAGGGCCACTTTCTCCTCGGTGTACAGAGGAATCACTATACTGCAAGGATCTTTTGAACGTTCTGACAGTAGAAGGTTGATGCTGTGAAAAAATCCTGTTGGTAAGAGTGAGTGGGATTTTGAAACTGTTTCCCTAGTTGTGGCACAGCTCTTGCTGCGAGGATTTGATCATAAGGATGTCAGATGAAAGCAAAGGCTTGCTAATGAATGGATCATATAATAAAGGTGCTATCTGATTATTTAGTTCTACAGCAGAACTCATTCTTTAAGCGGGTTAGACTATTTGGAAGCTACTTTCAGAATGGACACCTGGTCAGAAATATCTCGAGACATCTCATTTTTATTTGTATAAGTTCAAACATCTCAGTTTGGTAGCTGAGGGGATTCACAAATTACACAAACTATACACAAAGTATGGGAAGTTCATTTACAAGTTCTCTCGTGAAATATTCCTTATTCTCAAATAATTCGACTGACCGATACTTTGTGACACTGACTGCAGTCTCCCATGTATAGAGGAAAGGCAAATCTTAAGCACCAGACAGATTTGGCATAAATGTAGGTGGAACCTTGATTTTTAGCAAGGTTTCAGGCAGGCCCTTGGAACCTTGATGTAACAGGTTTTCTGCCTGGAACCTTGCAAAACATCAAGGTTCCACCTGCATTTATAGCAAGTCTGTCTGGTGCTCAAGGTTTGCTGGAAATAGAGAAAAGGCCTAACCAGATCTAA
   



Peptide Sequence
>MA_52027p0010[1002 residues] 
MENEAGPRVAYFSHPFPPGGFAQQKHGGTYRHQARNAGWNADSWEWDSLRFVAKPADEKSHGREGSNVQNAEASSRILHLGTHDSTNMRPENNKRKYSSEEEDAGNLTLKLGGSLYGDDSNSKTNKRFRSGFVSSSYPLCQVDDCRIDLTNAKDYHRRHKVCEPHSKASTALVGTVMQRFCQQCSRFHPLGEFDEGKRSCRRRLAGHNKRRRKTQAEEIGCRGFMTGDENGALRNFDIASLVAVLSHQHQASNSVDKLFDRRSLDKEHLIRCLSKLKSVPSLGDIGTTRPQLAIDLNVSQNMQPQAQAQDAKGKALQTNDRQSPVPDSEMLRILSTLTERSPEALSLLQRSLMAQKTLNSHNSYDQQTISQQFLNISPTLIASRDIDHVAISDGHENISKNSLSRGNLAWPVHHFNSSDGMHNPNLVVSKQYFKEDSCNPLEERFSSRSPSLSPPVVQKLFPLHSKDENKEIDSVSVCEEDELTPDQSPKDDGLCKFGLSNSGRRNDRHNISLSSPPAASDLRINGYTSSGSDQSPTSSNSDTKERTSRIIFKLFGKDPSDFPQTLRTQILEWLSHCPSDMESYIRPGCVILTIFASMPMAAWEQASKRGLARTDGKIRFCRSSSSLDAPEICSVWPIAVVAGEETRLVLRGHNLTTPGTKILCAYRGKYISQNVPEDYQVGSSAFFSNATTIEHKFPGGPANVFGRFFMEVERGFKGNNFPVIVADSAICRELRTLEGEFEGICEGKVIDWHSKPHSREDVVFGIQEDVVTFLNELGWLFQRNSYLKEGLFSPKDAPARFKFLLTYAVERNWNSLLKKVLDILFIMYGEEEGSVREAFSILSEIDLLHRAVKRNCRQVVDMLLCYVPSSSADRNIAFRPDVIGPGGLTPLHLAASMQNAEDVVDALTNDPQKIGLQAWTTALDANQQTPHAYALMRNNHTYNRLVLEKMADQRRAQAGPWNLDVTGFLPGTLQNIKVPPAFIASLSGAQGLLEIEKRPNQI*
   



PlantGenIE GeneLists

Gene Family Genes
Amborella trichopodascaffold00001.35; scaffold00062.234; scaffold00047.125; scaffold00106.114; scaffold00019.328; scaffold00013.75; scaffold00106.116; scaffold00022.95; scaffold00045.66; scaffold00022.228; scaffold00025.295; scaffold00106.115;
Arabidopsis thalianaAT1G53160; AT3G15270; AT1G02065; AT2G33810; AT1G20980; AT1G76580; AT1G69170; AT1G27370; AT1G27360; AT5G43270; AT5G50670; AT5G50570; AT2G42200; AT3G57920;
Oryza sativa ssp. japonicaOS07G32170; OS06G44860; OS02G08070; OS04G46580; OS08G40260; OS04G56170; OS01G18850; OS09G32944; OS11G30370; OS06G49010; OS08G41940; OS02G04680; OS01G69830; OS08G39890; OS09G31438; OS02G07780; OS06G45310;
Oryza sativa ssp. japonicaOL16G00740;
Physcomitrella patensPP00194G00270; PP00313G00360; PP00118G00040; PP00050G00830; PP00252G00180; PP00050G00810; PP00337G00300; PP00194G00290; PP00194G00280; PP00047G00100; PP00055G01330; PP00055G01310; PP00034G00190; PP00023G00470; PP00047G00090; PP00142G00660;
Picea abiesMA_52027g0010; MA_20537g0010; MA_92489g0010; MA_47367g0010; MA_3179g0020; MA_10427464g0040; MA_15381g0010; MA_10427464g0010; MA_10432997g0010; MA_7789506g0010; MA_10428252g0010; MA_383231g0010; MA_10427464g0020; MA_10434066g0020; MA_10434066g0010;
Pinus taedaPITA_000055947-RA; PITA_000005040-RA; PITA_000049918-RA; PITA_000019718-RA; PITA_000015271-RA; PITA_000019719-RA; PITA_000076050-RA; PITA_000038047-RA; PITA_000015270-RA; PITA_000006676-RA; PITA_000009555-RA; PITA_000071075-RA; PITA_000013856-RA; PITA_000055946-RA;
Populus trichocarpaPotri.001G398200; Potri.011G116800; Potri.007G138800; Potri.004G046700; Potri.011G055900; Potri.014G057800; Potri.014G057700; Potri.002G142400; Potri.002G142200; Potri.001G055900; Potri.002G002400; Potri.005G258700; Potri.018G149900; Potri.015G060400; Potri.003G172600; Potri.003G169400; Potri.001G058600; Potri.016G048500; Potri.015G098900; Potri.012G100700; Potri.010G154300; Potri.008G097900; Potri.019G073600; Potri.017G012900; Potri.007G094600;
Selaginella moellendorffiiSM00043G01810; SM00003G06070; SM00001G09470; SM00000G10470; SM00003G03910; SM00001G09390; SM00019G00710; SM00038G00340; SM00114G01040; SM00019G00700;
Vitis viniferaVV19G02630; VV12G01810; VV04G00180; VV10G01210; VV15G00640; VV18G13000; VV15G00650; VV08G09380; VV01G10730; VV01G04830; VV14G14240; VV11G10000; VV01G04980; VV17G08250;
Zea maysZM05G20900; ZM06G12410; ZM04G38860; ZM02G01890; ZM10G22810; ZM10G25440; ZM04G32390; ZM02G33260; ZM01G32860; ZM02G35980; ZM04G04680; ZM04G09800; ZM08G28910; ZM08G00050; ZM05G19280; ZM07G17920; ZM03G10450; ZM04G40100; ZM02G32760; ZM04G38990; ZM05G20590; ZM05G24390; ZM04G32240; ZM01G32560; ZM07G22580; ZM03G22640; ZM04G09820; ZM03G33210; ZM07G18640; ZM05G14950;

Map Image: 


Login | © 2019 PlantGenIE.org.| All our tools are under MIT License

  • GeneList
      view active genelist () here.
      genelist namegenesrename/delete
      add new genelist / save current list / cancel
  • Analysis
  • <