00       00

Click here to search
Bug Report
Report an error

P.abies 1.0 gene MA_464529g0010
Page views 35


Chromosome Start End Confidence Trinity id Subject length Subject coverage Subject strand Query strand
Loading data from server


Gene Description based on Blast2GO: G-type lectin S-receptor-like serine threonine- kinase At5g35370

Populus Transcript name:     Potri.002G086500.1
Arabidopsis id:     AT5G35370.1

Map Image: 


GO ID Name Space Description
GO:0005488molecular_functionbinding
GO:0004672molecular_functionprotein kinase activity
GO:0016310biological_processphosphorylation

PFAM ID Description
PF00069Protein kinase domain
PF00954S-locus glycoprotein family
PF01453D-mannose binding lectin
PF01636Phosphotransferase enzyme family
PF05445Poxvirus serine/threonine protein kinase
PF07714Protein tyrosine kinase
PF08276PAN-like domain
PF14295PAN domain

CDS Sequence
Legend:   CDS        START        STOP                         

>MA_464529g0010[2382 nucleotides] 
ATGAAGACGAGACGAAGTGAAGCGTTGCGATGGAATGGATTTATTCTTCTTCTTTTTCTGGTATGCGGAGGAGTGTGCTATGGACAGGATTCGATTGAACCCGGTTTCACGGCTTCCCCGATGAAATACCTGGATAAGGAAGTGCACAACGAGACCGGCGCCGTCGTCTGGTCGGCAAACCGCGACTTACCCATGGCGGATTCCGGTGAGTTCCGGCTCACCAAGACCGGTGCGGAGATACAGAATTCGGTTGGAGAAATCCTGTGGTCGGCCGCGATGAAAAACGGATCCATTGACGTGATAAAAATGAAATTGAGGGACGACGGCAATCTGGTGATGTTGGGCGCCGGCAGTAAGTCCCTGTGGGAGAGCTTCGACTATCCGACCAATACGCTTCTGACGGGACAGCGCTTGGTGCAAGGATCGAGTCTCGTCAGCAACGCGGCGGACACGAACTTCTCGCTGGGGGATTACAAGGTTTCGTTAACAGACCGGGACCTGGTGCTCGTTTGGAACAGTGGGGAGCCGCAGACGTACTGGAGCATGGCGAGGGCCAACGGGACGGTTCATTTGGGAGCCGATTTAACGGACGTCGGGTATGCTGCCTTGACAGACTCTGGGTTCAGTCTGTATTCGAAATCTAACGGTTCGTCCCTGGTGTGGCAATTAACAAACCCCGGCGGAGCACTGACACGGGCCGTGATCTGGCCTGGTGGACAATTTGAGATCTCGAGCTTAATCAAGGGCAACTGGGTGACCGACTTAAACGCCGTAAAGGATGCCTGTCTGTTGCCCAAGACGTGCGGCTCGTTGGGGGTTTGCACAGGGCTTACGCCCACGGGCCCTCCCCAGTGCTCGTGCCCGGCCAGGCTGCAGTTCATCAATCAAACGGACGCCTCTGAGGGTTGCAGCACCAGATGGAAGACTCCGGGCTGCGATGCGAATTACACGGATCTGTTGACGAAAAAGTTTGTCCAGTTTGTCAGCCTCGGGCAGGGTGTGGATTATTTCGCCGATCAGTTTCAGAACCCGATCCGGAGCTCTATAAGTTTCAGCGACTGCCAGCAGCTATGCTTGAAAAATTGTTCTTGCGCCGGTTTTTCTTTCAAAAAGGACTCCGGTTCTTGTTTTGTGCACGAAACCCTGGGGACTCTGATAAGCAATTACACTCTGGATTCGGCTTTCTTGAAAGTGATCCGCACAGAGAATCCGGTCTTACTAATTGTACTCGGATCAGTCGGGGCCGTTTTGGTCGCCGCTATGTTGATTAGTATCGGCTGGCTGTTGTGTCGAAAGCATGGCCAACAAATCCTTCCTCGGTTCCCGGATTCGTCAGATGTGGACGACGAGCACGTCCTGCAATCGATCGGCGGTCTCCCGACGCGGTTCTCCTACAAGGATCTCCAGACCGCCACGAACAACTTCGCTCACGCGATCGGCTCGGGCGCCTACGCGGTCGTGTACGAGGGTACGTTGCCCGACGCCACAAAGGTTGCGGTCAAGAAGCTCCACAGCAGTGACAGCACCACCGATGGTAAGCGAAGGGAGGAATTCATTATGGAGATCACCACAATCGGCAGCATACAGCACGTGAACCTCGTAAAGCTCCGGGGCTTTTGCGTTGAGGGGCCAAACCGGCTCCTGGCGCTCGCCTATCTCCACGATGAGTGCAGCGAAAAGATCATACACTGCGACATCAAGCCCGAGAACATCCTCCTCGACGACGAATCGCAGACTAAGGTGTCCGATTTTGGGCTCGCGAAACTCATGAGCCGAGACCAATCGCAGGCCATGATGAGCAACATGAGAGGCACCCGTGGTTACATGGCGCCAGAGTGGCTCACCCACGCGCCCATTTCACACAAAATCGACGTCTACAGCTACGGCATGGTGCTCCTCGAGATCGTCTCCGGCCGCAAAAACTTTTCCCAGCCGAATTCATTTTCAAACACCGACTCCATTTTCGATCTCAGCTTTAACCTAAATTACTTCCCGGCTTATGCACTGCAGCTCTGCCAAATGGGAGGACCCTTTACCGTGCTTGCTGACCCCAGGTTGGAAGGAAGGTTCCCTGCCGAAGAAGTCAATAGACTGGTAAAGATTGCGCTCTGTTGCTTGCACGAGGATTCGAAGATGAGACCTAGCATGTCAAAGGTAGTGCAGATGCTTGAGGGGAACTTGCGTGTGGACGATCCGCAGGTGGAGTCGTTGCTGTTTCTGAGGGTTTATGCGAGGAGAATCAATTCCCACATACCTACCTCTGAGGCGTCTTCGTTCGTGGGCAGCGGGGAGTATTCTACATACACGACTAGATCGTCTTCCTTCAATTCGCCTACGCAGATGTCGATGATTTCCGCAGCTCAGCTTTCTGAAGCTAGATAG
   



Genomic Sequence (+ strand)     upstream:    downstream:   
Legend:   CDS                         

>MA_464529:3501-6125[2625 nucleotides] 
ATGAAGACGAGACGAAGTGAAGCGTTGCGATGGAATGGATTTATTCTTCTTCTTTTTCTGGTATGCGGAGGAGTGTGCTATGGACAGGATTCGATTGAACCCGGTTTCACGGCTTCCCCGATGAAATACCTGGATAAGGAAGGTTTCTTCTTGCGTTCCAGTAACGGGACCTTCTGGCTTCAACTGTACAATCCGGCAATGGACCAGAATTATTATCTCTGCATAGTGCACAACGAATTATTATCTCTGCATAGTGCACAACGAGACCGGCGCCGTCGTCTGGTCGGCAAACCGCGACTTACCCATGGCGGATTCCGGTGAGTTCCGGCTCACCAAGACCGGTGCGGAGATACAGAATTCGGTTGGAGAAATCCTGTGGTCGGCCGCGATGAAAAACGGATCCATTGACGTGATAAAAATGAAATTGAGGGACGACGGCAATCTGGTGATGTTGGGCGCCGGCAGTAAGTCCCTGTGGGAGAGCTTCGACTATCCGACCAATACGCTTCTGACGGGACAGCGCTTGGTGCAAGGATCGAGTCTCGTCAGCAACGCGGCGGACACGAACTTCTCGCTGGGGGATTACAAGGTTTCGTTAACAGACCGGGACCTGGTGCTCGTTTGGAACAGTGGGGAGCCGCAGACGTACTGGAGCATGGCGAGGGCCAACGGGACGGTTCATTTGGGAGCCGATTTAACGGACGTCGGGTATGCTGCCTTGACAGACTCTGGGTTCAGTCTGTATTCGAAATCTAACGGTTCGTCCCTGGTGTGGCAATTAACAAACCCCGGCGGAGCACTGACACGGGCCGTGATCTGGCCTGGTGGACAATTTGAGATCTCGAGCTTAATCAAGGGCAACTGGGTGACCGACTTAAACGCCGTAAAGGATGCCTGTCTGTTGCCCAAGACGTGCGGCTCGTTGGGGGTTTGCACAGGGCTTACGCCCACGGGCCCTCCCCAGTGCTCGTGCCCGGCCAGGCTGCAGTTCATCAATCAAACGGACGCCTCTGAGGGTTGCAGCACCAGATGGAAGACTCCGGGCTGCGATGCGAATTACACGGATCTGTTGACGAAAAAGTTTGTCCAGTTTGTCAGCCTCGGGCAGGGTGTGGATTATTTCGCCGATCAGTTTCAGAACCCGATCCGGAGCTCTATAAGTTTCAGCGACTGCCAGCAGCTATGCTTGAAAAATTGTTCTTGCGCCGGTTTTTCTTTCAAAAAGGACTCCGGTTCTTGTTTTGTGCACGAAACCCTGGGGACTCTGATAAGCAATTACACTCTGGATTCGGCTTTCTTGAAAGTGATCCGCACAGAGAATCCGGTCTTACTAATTGTACTCGGATCAGTCGGGGCCGTTTTGGTCGCCGCTATGTTGATTAGTATCGGCTGGCTGTTGTGTCGAAAGCATGGCCAACAAATCCTTCCTCGGTTCCCGGATTCGTCAGATGTGGACGACGAGCACGTCCTGCAATCGATCGGCGGTCTCCCGACGCGGTTCTCCTACAAGGATCTCCAGACCGCCACGAACAACTTCGCTCACGCGATCGGCTCGGGCGCCTACGCGGTCGTGTACGAGGGTACGTTGCCCGACGCCACAAAGGTTGCGGTCAAGAAGCTCCACAGCAGTGACAGCACCACCGATGGTAAGCGAAGGGAGGAATTCATTATGGAGATCACCACAATCGGCAGCATACAGCACGTGAACCTCGTAAAGCTCCGGGGCTTTTGCGTTGAGGGGCCAAACCGGCTCCTGGTCTACGAGTTCATGAACCGTGGCTCACTGGACCGGTCTCTCTTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGTGGAAAGAGCGCTATGCTATCGCGCTGGGCACCGCAAAGGCGCTCGCCTATCTCCACGATGAGTGCAGCGAAAAGATCATACACTGCGACATCAAGCCCGAGAACATCCTCCTCGACGACGAATCGCAGACTAAGGTGTCCGATTTTGGGCTCGCGAAACTCATGAGCCGAGACCAATCGCAGGCCATGATGAGCAACATGAGAGGCACCCGTGGTTACATGGCGCCAGAGTGGCTCACCCACGCGCCCATTTCACACAAAATCGACGTCTACAGCTACGGCATGGTGCTCCTCGAGATCGTCTCCGGCCGCAAAAACTTTTCCCAGCCGAATTCATTTTCAAACACCGACTCCATTTTCGATCTCAGCTTTAACCTAAATTACTTCCCGGCTTATGCACTGCAGCTCTGCCAAATGGGAGGACCCTTTACCGTGCTTGCTGACCCCAGGTTGGAAGGAAGGTTCCCTGCCGAAGAAGTCAATAGACTGGTAAAGATTGCGCTCTGTTGCTTGCACGAGGATTCGAAGATGAGACCTAGCATGTCAAAGGTAGTGCAGATGCTTGAGGGGAACTTGCGTGTGGACGATCCGCAGGTGGAGTCGTTGCTGTTTCTGAGGGTTTATGCGAGGAGAATCAATTCCCACATACCTACCTCTGAGGCGTCTTCGTTCGTGGGCAGCGGGGAGTATTCTACATACACGACTAGATCGTCTTCCTTCAATTCGCCTACGCAGATGTCGATGATTTCCGCAGCTCAGCTTTCTGAAGCTAGATAG
   



Peptide Sequence
>MA_464529p0010[793 residues] 
MKTRRSEALRWNGFILLLFLVCGGVCYGQDSIEPGFTASPMKYLDKEVHNETGAVVWSANRDLPMADSGEFRLTKTGAEIQNSVGEILWSAAMKNGSIDVIKMKLRDDGNLVMLGAGSKSLWESFDYPTNTLLTGQRLVQGSSLVSNAADTNFSLGDYKVSLTDRDLVLVWNSGEPQTYWSMARANGTVHLGADLTDVGYAALTDSGFSLYSKSNGSSLVWQLTNPGGALTRAVIWPGGQFEISSLIKGNWVTDLNAVKDACLLPKTCGSLGVCTGLTPTGPPQCSCPARLQFINQTDASEGCSTRWKTPGCDANYTDLLTKKFVQFVSLGQGVDYFADQFQNPIRSSISFSDCQQLCLKNCSCAGFSFKKDSGSCFVHETLGTLISNYTLDSAFLKVIRTENPVLLIVLGSVGAVLVAAMLISIGWLLCRKHGQQILPRFPDSSDVDDEHVLQSIGGLPTRFSYKDLQTATNNFAHAIGSGAYAVVYEGTLPDATKVAVKKLHSSDSTTDGKRREEFIMEITTIGSIQHVNLVKLRGFCVEGPNRLLALAYLHDECSEKIIHCDIKPENILLDDESQTKVSDFGLAKLMSRDQSQAMMSNMRGTRGYMAPEWLTHAPISHKIDVYSYGMVLLEIVSGRKNFSQPNSFSNTDSIFDLSFNLNYFPAYALQLCQMGGPFTVLADPRLEGRFPAEEVNRLVKIALCCLHEDSKMRPSMSKVVQMLEGNLRVDDPQVESLLFLRVYARRINSHIPTSEASSFVGSGEYSTYTTRSSSFNSPTQMSMISAAQLSEAR*
   



PlantGenIE GeneLists

Gene Family Genes
Picea abiesMA_361139g0010; MA_11330g0010; MA_218947g0010; MA_10428516g0010; MA_10310998g0010; MA_14446g0010; MA_464529g0010; MA_10429842g0010; MA_36134g0010; MA_166153g0010; MA_36134g0020; MA_8972765g0010; MA_8845129g0010; MA_10164346g0010; MA_6824769g0010; MA_13270g0010; MA_618599g0010; MA_499559g0010; MA_10426854g0010;
Pinus taedaPITA_000029196-RA; PITA_000011528-RA; PITA_000049637-RA; PITA_000040943-RA; PITA_000035787-RA; PITA_000027514-RA; PITA_000059841-RA; PITA_000009169-RA; PITA_000024812-RA; PITA_000032700-RA; PITA_000047805-RA; PITA_000030057-RA; PITA_000028079-RA; PITA_000035788-RA; PITA_000074959-RA; PITA_000048904-RA; PITA_000054434-RA; PITA_000054435-RA; PITA_000054436-RA; PITA_000035791-RA;
Selaginella moellendorffiiSM00043G00590; SM00010G02960; SM00002G01110; SM00002G02380; SM00039G00820; SM00002G00120; SM00002G04220;

Map Image: 


Login | © 2019 PlantGenIE.org.| All our tools are under MIT License

  • GeneList
      view active genelist () here.
      genelist namegenesrename/delete
      add new genelist / save current list / cancel
  • Analysis
  • <