00       00

Click here to search
Bug Report
Report an error

P.abies 1.0 gene MA_175530g0010
Page views 39


Chromosome Start End Confidence Trinity id Subject length Subject coverage Subject strand Query strand
Loading data from server


Gene Description based on Blast2GO: G-type lectin S-receptor-like serine threonine- kinase At1g34300

Populus Transcript name:     Potri.010G103300.1
Arabidopsis id:     AT1G34300.1

Map Image: 


GO ID Name Space Description
GO:0016301molecular_functionkinase activity

PFAM ID Description
PF00069Protein kinase domain
PF00954S-locus glycoprotein family
PF01453D-mannose binding lectin
PF07502MANEC domain
PF07714Protein tyrosine kinase
PF08276PAN-like domain
PF08277PAN-like domain

CDS Sequence
Legend:   CDS        START        STOP                         

>MA_175530g0010[2586 nucleotides] 
ATGTACACTGTGCCGCAGTTTTTCCTTACGTTTTTATTTACGCAGTTACTGATTTTGGTGGGTTGTGGGGAGGGAGGGCAAGAGCATACAAGTGAATTTGTTATCTCCTCTACTAGACTGAAAAATTCTGGTTGGAGGCCTGGGAATAACACATATCTGGTTTCTCCAAACGGGACATTCTGTGCCGGTTTCTATAATGTTACTCCAAATAATTATGCTTTTGCTGTCTGGTATGCCAACGATCCTAATCGAACCGTGGCATGGATGGCTAATAGAGATCATCTCATAGGCTACAATTCTTCCCTAACCTTAAAGGATGGAAATCTCACTATATCTGACTCCGATGCCCATGAAATATGGAGTGCGACGATCCTAGCTTCCAATGCTGGAATGGACATGATTTTGCTGGAATCGGGGAATTTGGTCTTCAGTACAAGCAACGAGAACCATGTTTGGCAGAGCTTCGACTCTCCTACGTTTACACTTCTTCCAACACAGAGATTCTCAGAGAACAGTAGATTAGTTTCGAGAAGAAATGATAGCACCTACTCCTCAGGTGCCTACATCTTCTCTGCCTCTCAGTCCAACACGCAAACACCCTCCTTGTATTATAACAGGAGCGAATTAGGATCAGATCAACTTGATTTGTATGGGGTTTTGCATTGGCTTTTGGCAACTAATTATGGCATTCAATTTAGTCTGGGCGTTGATGGGTATCTAAGTTTAGGCGATGATGGGAATCTGATAAACTCAAGCAACTCGAAGATTTTGATGGCATCAGACAGTGGGGATCCCGCCGGTCCCTTAAGAAGATTAACTTTAGACCACGATGGAAATCTCCGAATTTACAGTTGGAAGCGGGACTCATCTTCTTCTTGGGTAGTAGTCTGGGAAGCAATACAAGAGCGTTGTCAAATTCACGGCACTTGTGGAGACAACGCTATATGCAAGACTCCCGAATTGAACAACAGTACGCCAGAATGCCAATGTCCACCCGGTTTCCATCAAAATATTACTGATCCTCCCAGCTGCCAGAGAACTATTCAATTTTCCAATCTGTCGTGCAGTTCTAATTATCAGAGTATCGACAATCAATTTATCCCGTTGGATTATGTTTTTTTCACGGGAGAAAGGAATCAGACAAATTTGAATGTTCCGAGATTCGAAGACTGTATGTCAGCTTGTTTGAACAACTGCGAATGTGTGGGTTTCTACAAATGGGACGGCAGTCGATCCTGCGTCCACCTTTTTGGCAGATTACTGAATGGATATTGGTCTCCGGAATCGAAAACACGCACGTACTTGAAGCTGTCTGCAAAAGAGAAAAATGTCTCAAATCCATACACGGGTATGCTCTCTGTGGTGGAAAATGTTTGCGAAGTTACTTTGGCTCTGCCGTTTCCGCCAGAACCGAGTAATCTAATCATAATTTACTCTATATTTGGCATCGAGCTTTTCTGTGGAGTTTTGGTTTTCTGGGCATTTCTGAGGAGGTTCTCCAGATATAGACACATAGCTAGAATATTCAGTTCAGATATTCTACTTTATCTTTCAGGCGGGGGGCCAAAGAGATTCACATACGCAGAGCTGAAAGCCGCGACTAATCATTTCAGTGATGAAGTGGGCAGAGGAGGATTCGGGACGGTGTACAGAGGTGTTCTGCCTGATCAGAGACAGATTGCAGTGAAGAAGCTCAAGGGGGTATCTCAAGGTGAAGAGCAATTCTGGGCAGAGGTGACAATTATAGGGAGAATCCATCATCTCAACCTTGTTCGTATGTGGGGTTTCTGCACAGAGGGTGAACACAGATTGCTTGTGTACGAGTACATACCCAACGGGTCATTAGACAAATATTTTTTTGATAACCAGGGCGGAGGCGAAAGAGTTGTGTTGGACTGGAGCAGACGATATCGAATAGCAGTGGGGGTAGCCAGAGCCATAGCCTACATGCACGAAGAGTGCTTGGAATGGGTTCTCCATAGAGATATCAAACCGGAGAACTTACTCTTGGATGATGACTATTGTCCCAAGATATCTGATTTTGGCCTAGCAAAGCTGGTTGAGAGAGAGCGCAGCTTGAGCGTGTCTAACATCAGAGGGACTCCTGGATATCTGGCACCAGAATACTGGATACAGGAAAACCAGCCTATTACTGCAAAAGTAGATGTATACAGCTTTGGGATTGTGCTTCTGCAGATTGTAAGCGGAAGGAAGAATCTATGCTTCAGTCAATCCACTGACGAGGGCGATGAATGGTTCTTTCCAAAGAAGGCTTTTGAGTGGGCGGTTTTGGGGAGGCATATGGAAGAGGTCGTGGACAAAAACATTGTGAGTGTAGCAAGAGATGATCGCTTTCAGTTGGAGGCCATTGAGAGAATGGTGAAAACAACGTTTTGGTGTATTCAGAGCCGACCAGATGACAGGCCTTCCATGGGAAATGTTGCTAAAATGCTGCAAGGAACCCTCGCAGTTCCCCAACCTCCTCAGCCTAATTTCTTCCTGAACTTCTTGAACGCCAATAGCAGCGAATATGGAGATCACATACAAGAATTGCCTCCGATTTCTGTTTCTACGCAGGAAATTTAA
   



Genomic Sequence (+ strand)     upstream:    downstream:   
Legend:   CDS                         

>MA_175530:16888-19473[2586 nucleotides] 
ATGTACACTGTGCCGCAGTTTTTCCTTACGTTTTTATTTACGCAGTTACTGATTTTGGTGGGTTGTGGGGAGGGAGGGCAAGAGCATACAAGTGAATTTGTTATCTCCTCTACTAGACTGAAAAATTCTGGTTGGAGGCCTGGGAATAACACATATCTGGTTTCTCCAAACGGGACATTCTGTGCCGGTTTCTATAATGTTACTCCAAATAATTATGCTTTTGCTGTCTGGTATGCCAACGATCCTAATCGAACCGTGGCATGGATGGCTAATAGAGATCATCTCATAGGCTACAATTCTTCCCTAACCTTAAAGGATGGAAATCTCACTATATCTGACTCCGATGCCCATGAAATATGGAGTGCGACGATCCTAGCTTCCAATGCTGGAATGGACATGATTTTGCTGGAATCGGGGAATTTGGTCTTCAGTACAAGCAACGAGAACCATGTTTGGCAGAGCTTCGACTCTCCTACGTTTACACTTCTTCCAACACAGAGATTCTCAGAGAACAGTAGATTAGTTTCGAGAAGAAATGATAGCACCTACTCCTCAGGTGCCTACATCTTCTCTGCCTCTCAGTCCAACACGCAAACACCCTCCTTGTATTATAACAGGAGCGAATTAGGATCAGATCAACTTGATTTGTATGGGGTTTTGCATTGGCTTTTGGCAACTAATTATGGCATTCAATTTAGTCTGGGCGTTGATGGGTATCTAAGTTTAGGCGATGATGGGAATCTGATAAACTCAAGCAACTCGAAGATTTTGATGGCATCAGACAGTGGGGATCCCGCCGGTCCCTTAAGAAGATTAACTTTAGACCACGATGGAAATCTCCGAATTTACAGTTGGAAGCGGGACTCATCTTCTTCTTGGGTAGTAGTCTGGGAAGCAATACAAGAGCGTTGTCAAATTCACGGCACTTGTGGAGACAACGCTATATGCAAGACTCCCGAATTGAACAACAGTACGCCAGAATGCCAATGTCCACCCGGTTTCCATCAAAATATTACTGATCCTCCCAGCTGCCAGAGAACTATTCAATTTTCCAATCTGTCGTGCAGTTCTAATTATCAGAGTATCGACAATCAATTTATCCCGTTGGATTATGTTTTTTTCACGGGAGAAAGGAATCAGACAAATTTGAATGTTCCGAGATTCGAAGACTGTATGTCAGCTTGTTTGAACAACTGCGAATGTGTGGGTTTCTACAAATGGGACGGCAGTCGATCCTGCGTCCACCTTTTTGGCAGATTACTGAATGGATATTGGTCTCCGGAATCGAAAACACGCACGTACTTGAAGCTGTCTGCAAAAGAGAAAAATGTCTCAAATCCATACACGGGTATGCTCTCTGTGGTGGAAAATGTTTGCGAAGTTACTTTGGCTCTGCCGTTTCCGCCAGAACCGAGTAATCTAATCATAATTTACTCTATATTTGGCATCGAGCTTTTCTGTGGAGTTTTGGTTTTCTGGGCATTTCTGAGGAGGTTCTCCAGATATAGACACATAGCTAGAATATTCAGTTCAGATATTCTACTTTATCTTTCAGGCGGGGGGCCAAAGAGATTCACATACGCAGAGCTGAAAGCCGCGACTAATCATTTCAGTGATGAAGTGGGCAGAGGAGGATTCGGGACGGTGTACAGAGGTGTTCTGCCTGATCAGAGACAGATTGCAGTGAAGAAGCTCAAGGGGGTATCTCAAGGTGAAGAGCAATTCTGGGCAGAGGTGACAATTATAGGGAGAATCCATCATCTCAACCTTGTTCGTATGTGGGGTTTCTGCACAGAGGGTGAACACAGATTGCTTGTGTACGAGTACATACCCAACGGGTCATTAGACAAATATTTTTTTGATAACCAGGGCGGAGGCGAAAGAGTTGTGTTGGACTGGAGCAGACGATATCGAATAGCAGTGGGGGTAGCCAGAGCCATAGCCTACATGCACGAAGAGTGCTTGGAATGGGTTCTCCATAGAGATATCAAACCGGAGAACTTACTCTTGGATGATGACTATTGTCCCAAGATATCTGATTTTGGCCTAGCAAAGCTGGTTGAGAGAGAGCGCAGCTTGAGCGTGTCTAACATCAGAGGGACTCCTGGATATCTGGCACCAGAATACTGGATACAGGAAAACCAGCCTATTACTGCAAAAGTAGATGTATACAGCTTTGGGATTGTGCTTCTGCAGATTGTAAGCGGAAGGAAGAATCTATGCTTCAGTCAATCCACTGACGAGGGCGATGAATGGTTCTTTCCAAAGAAGGCTTTTGAGTGGGCGGTTTTGGGGAGGCATATGGAAGAGGTCGTGGACAAAAACATTGTGAGTGTAGCAAGAGATGATCGCTTTCAGTTGGAGGCCATTGAGAGAATGGTGAAAACAACGTTTTGGTGTATTCAGAGCCGACCAGATGACAGGCCTTCCATGGGAAATGTTGCTAAAATGCTGCAAGGAACCCTCGCAGTTCCCCAACCTCCTCAGCCTAATTTCTTCCTGAACTTCTTGAACGCCAATAGCAGCGAATATGGAGATCACATACAAGAATTGCCTCCGATTTCTGTTTCTACGCAGGAAATTTAA
   



Peptide Sequence
>MA_175530p0010[861 residues] 
MYTVPQFFLTFLFTQLLILVGCGEGGQEHTSEFVISSTRLKNSGWRPGNNTYLVSPNGTFCAGFYNVTPNNYAFAVWYANDPNRTVAWMANRDHLIGYNSSLTLKDGNLTISDSDAHEIWSATILASNAGMDMILLESGNLVFSTSNENHVWQSFDSPTFTLLPTQRFSENSRLVSRRNDSTYSSGAYIFSASQSNTQTPSLYYNRSELGSDQLDLYGVLHWLLATNYGIQFSLGVDGYLSLGDDGNLINSSNSKILMASDSGDPAGPLRRLTLDHDGNLRIYSWKRDSSSSWVVVWEAIQERCQIHGTCGDNAICKTPELNNSTPECQCPPGFHQNITDPPSCQRTIQFSNLSCSSNYQSIDNQFIPLDYVFFTGERNQTNLNVPRFEDCMSACLNNCECVGFYKWDGSRSCVHLFGRLLNGYWSPESKTRTYLKLSAKEKNVSNPYTGMLSVVENVCEVTLALPFPPEPSNLIIIYSIFGIELFCGVLVFWAFLRRFSRYRHIARIFSSDILLYLSGGGPKRFTYAELKAATNHFSDEVGRGGFGTVYRGVLPDQRQIAVKKLKGVSQGEEQFWAEVTIIGRIHHLNLVRMWGFCTEGEHRLLVYEYIPNGSLDKYFFDNQGGGERVVLDWSRRYRIAVGVARAIAYMHEECLEWVLHRDIKPENLLLDDDYCPKISDFGLAKLVERERSLSVSNIRGTPGYLAPEYWIQENQPITAKVDVYSFGIVLLQIVSGRKNLCFSQSTDEGDEWFFPKKAFEWAVLGRHMEEVVDKNIVSVARDDRFQLEAIERMVKTTFWCIQSRPDDRPSMGNVAKMLQGTLAVPQPPQPNFFLNFLNANSSEYGDHIQELPPISVSTQEI*
   



PlantGenIE GeneLists

Gene Family Genes
Oryza sativa ssp. japonicaOS10G01100;
Picea abiesMA_175530g0010; MA_132034g0010; MA_919101g0010; MA_8255g0020; MA_323825g0010; MA_10366400g0020; MA_10366400g0010; MA_10426239g0010; MA_10426990g0010; MA_10149363g0010; MA_4233271g0010; MA_381231g0010; MA_9108267g0010;
Pinus taedaPITA_000014805-RA; PITA_000014806-RA; PITA_000014810-RA; PITA_000033685-RA; PITA_000078530-RA; PITA_000014803-RA; PITA_000063893-RA; PITA_000092512-RA; PITA_000069362-RA; PITA_000093180-RA; PITA_000053208-RA; PITA_000070976-RA; PITA_000091747-RA; PITA_000030574-RA; PITA_000076741-RA;
Zea maysZM01G23190;

Map Image: 


Login | © 2019 PlantGenIE.org.| All our tools are under MIT License

  • GeneList
      view active genelist () here.
      genelist namegenesrename/delete
      add new genelist / save current list / cancel
  • Analysis
  • <