00       00

Click here to search
Bug Report
Report an error

P.abies 1.0 gene MA_1151g0010
Page views 40


Chromosome Start End Confidence Trinity id Subject length Subject coverage Subject strand Query strand
Loading data from server


Gene Description based on Blast2GO: Zinc finger CCCH domain-containing 14-like

Populus Transcript name:     Potri.016G046600.1
Arabidopsis id:     AT5G06770.1

Map Image: 


GO ID Name Space Description
GO:0005488molecular_functionbinding

PFAM ID Description
PF00013KH domain
PF00642Zinc finger C-x8-C-x5-C-x3-H type (and similar)
PF08352Oligopeptide/dipeptide transporter, C-terminal region
PF13014KH domain

CDS Sequence
Legend:   CDS        START        STOP                         

>MA_1151g0010[825 nucleotides] 
ATGGAGTCGTTACCAACAGGTTTAAGAAGCAAATCAAAGGCATGCACCAAATTTTTCAGTACATCTGGTTGCCCATTTGGAGAGAACTGTCATTTCATGCACTATATCCCTGGCGGTATGAATTTGATTTCTCAGGTGTCAAATTTGGGAAGTGGTCTGGGCACAGCTTCAAGGAAATCAACAGGTCCCCCAACTAGCATTTTGCCTTCTGATCAGGCAGCTCCTGTACAGCCATACAAGACACGGATTTGTAATCGCTATGGGACTGCAGAAGGATGCCGGTTTGGAGATAAGTGTCATTTTGCCCACAGTGAAAATGAACTGAAGAAAGGCAATACACTTGCTCCTGTTGAGAGGGAACGGACATTAAGCAAGGATGCCGTTCCTGGTGTGATGGATGGCAGGCCTGGAGGTAGACTTGTGCAGCGTGAGCCTACACCACCTGGAATGGCAGCGGCAGCTTCATTTGGTGCTTCAGCAACAGCAAAAATCAGTGTCGATGCTTCTCTTGCTGGTGCCATTATTGGAAAAGGTGGTGTAAACTCCAAGCAGATTTGTCACACAACTGGAGCAAAACTAGCTATAAGAGATCACGAATCCGATTCCAATCTAAAGAACATTGAGCTGGAAGGTAGCTTTGATCAGATAAAACTAGCCAGTACCATGGTTCATGAGCTGATAATGCAAACTAGCGCTGTAGCTGCAAAACCATCTGGATTTGTTTTCAACAATTACAAAACAAAGGTGTGTGAGAATTTTTCCCAGGGTACCTGCACATTTGGGGATCGTTGCCACTTTGCACATGGTGCCAGTGAACTTCGGTAA
   



Genomic Sequence (+ strand)     upstream:    downstream:   
Legend:   CDS                         

>MA_1151:6226-26751[20526 nucleotides] 
ATGGAGTCGTTACCAACAGGTTTAAGAAGCAAATCAAAGGCATGCACCAAATTTTTCAGGTTCTAATCCAAACCTATTAAATGTTTTTTCCTAATTGAGCAGTCTTGTTTATATAACTCAGGTAAGCAAAGTTAATGCCATTTTTATATTGAGCCTAATATATTATGTATTGCAATCTACTTTCTAAAGTCACGTTGAGCAAATATTTCTTTTTAAAAAACCGATGGCAGTCATCTAAACTTGTGCTACAGGTGTATGGTGCTTTTTGTTCTAACCAAGCTTAATGAAGAAATTTGAACACAGTGGTGTTTTTTTAATCATTGACTGCAAACCAGGAAACTTGATGGGATAAAGGTTTCTTAATATTTCTTCTACTTACAAAAAATCTTAAGTACTGGAAGTCTTCTTAACGTATTTATAGTATATACAGCTATTCCTCCCAATCAAGAAAACTGCTGTTGGCTGTTACCTTTATTTATGGAATTTATTTGAAGCTATCCCAAACGAGCTTATGAAACAGGTTTGTATTTATGTCTAGGAAGCTGTTTCTTACTAGATGGGGTATTGTGTTCTGGATGACCTAAACCAGCAGCGTTACCTAATTAGTCAAATATAATGTCCTATAAGTCTGTTTTGTCTTAGTCAAGATCCTTTGTTGTTTTGCACATTTTAATATTTTCCCCAGTATCTGCTATGCTAAATAGTTCACACTTTATTTGTTTTTTGTCCACAGTTTGGAAGATTAATTTACCACATTTTTGGGAAAGGGGAGAACTTCATAAATGATTCAAGAACTAGATAAAGACAGATGAGTGTATTAACATAGTGCAGCATGTCATTACACATGACCTTACTTCCTTCTTTGGAATCTATTGTTATAGCATCTCCTCCACTAAAATGAAACCTTGCACTGCATATATATATATATATATATTCCAAGGAAAACCTCTCAGGGAAACCCATGGGATTCTTCCACACATTCGTGAATGACATCCCTAGTAAACGCATCGGTGTAGACTAGTGCGCCTCACCCAGGGGGGTTCAAACTGGGTACGTTCTGGTAAGGATCTAGCCAAATACCCAGCAACATTGGCGACAATCAGTTGAGATAACCCACTGGGCTGCATCTATTGTTATATATGAAAGTAGTATTTGACAATAATCTACAATCAATTATGCTAAATGTTTTTTTTTACCTGGGAATGTAAGCAATGTCTGATGTGCATCTTCTTACCTCTATCTAAAAAGCCATGCATGAAATTTTTTAAATTTGGTTGCATATGCCATATTGTAATCTATGATAAGAGTTAAAAAATTGGATGGGGGATTTAGGCTGTGGTGATCAGATGTAAACATATTTCTAGATTAATTTTGGGTATGGACATGAATACAGGAGCAGGTATGGAGGTGGAGAAGAGCATTGTTAAGTTTTAAAATTGGTGGGAGATGTGACTTTCTATTCATTTTAGCTTTTAGTGTGGGTCCTAAAACAAGCTACACATAAATGAAAGGGTTCTATCGTGAGATTTGTTGTCAACCAATTTTTCAGAGGAGCTTCAGAAGATCTATTCAGAAAATGGATCCCAGGTGAAGCCTTCAGGGATCCAAGGATCTAGTATATGGATTTGTCACTGTACTTGGAAGGACTGGGTAACATAGCTTTAAATTTCAGTTTGTGTTCTATGGTGACTTAGTTGAGGGCTTGTGTTTTCAAAAAGCCAAGCTTCTTTGCATGCCACGGTCAAATTGAAACTCAACAATTTGTCAATAATGGATAGGTGATCCAATGGTATTTCTTTAGTACATTAATAGGCTAGAAGCTTCTAAAGCTAGGCTATTAATAGGCTAGGCTATTTCTTTAGTACAATAATAGACTAGAAGCACACTAAAGAAATACACTAAAAGCCCATATGACTATTGACTAGTACATTAGACCAAGTTAGTCTTAGGAATCTCTTAATGTTCTATATCTTAACATCCCACATACATCCCACAAAGCGACATAAGAATATATGAATTACACCTATACCCCATTTATGACAACATCCTTCACACCTGACGTAGAATGAAGATGTAGAAAGACGCCCTGTTAAGGGATTTGTGTGCAGTGCATTGATGCTGAACTGGATGCCTAGGAATTGCAATAAAGCTGTGAAAGAATGATTTCCAAAATATGTCACAGAGGGTGGCAATGCTGAAGTTGAAAGGATCTGACGATGCTGTAGGCAAGTGTTGAATATCCCACAAGAGTGCTCCAATCAAACTAAAAACAAATACTCCAAACAACACCTATGCTAAGATGCCATCCCATCATAAAAGGCACATGTACAAAGGAAGCAAAAGACGCTGCCATCATAACTGTCAAGGGCACTGAAAGCACTGAAGCTGAAAAGTTCAAGGCATATGCTCCAAAAGGAAAAAAAAACGATTGATGATCAACAAGAATGCTTCAAGAAACCTAAGAATCTTGCAAACTCTGAAAGTGATCTGATGAAGCTGTCGCCAAGTGTAGTAGATTAAACAATGCTTCAAGGAATTAAGGAGAGCTAACCCACCTTTCAGGCAAAGAGTCAAAAACTCGTTAAGTGCTCCTAGTAACATGAGCCAAAATGCATGTGTACAAGGAAGAAACAAAAATATTGCATCATAATTCTCGTGTGCTGAGGTTGAAAATATAAAGTGTAGATGCTTTAAAAGGAAAAAAAATTGTTTGTGATCAACATAGGTGGTGCCAGCGTACAAAGATGGAAACAAACATTATCTGTTGAATGTGTCGGCTTTGAAGATGATCTGATGCAGAGGCAGAAAAATACACAAATCTGTCAACGATCATCATAAATGCTTCAAGCAAAAATGGTGCCATCATAAAAATGCTAGACAAACATCAAAGTTGTCAAGATGGTTGATGTGCTGATGCTAAAGTAGAGCAGATGCAGAGGCACAAAAAGACAAAATTCTGACAACAATCAACAGAAGTGTTCTAGGCAAATGACGGTGCCAGTGTAAAAAAATATGGATATGTGCTTCACGAAAAGGAAGCAAACTTTGAAGCTGTCAAGATGGTTGAAAGTGCTGAAGTTGAAGAAGATTGAATGTAGATGCACAAAAAGGCAAAAAACTGACAATGATCAACACAAATGCTCCAAGCAAAAAATGGTGCTAATGTAAAAAAGCTGGAAAAACACTAAGCCGTCAAGATGTATGATGTGTTGAAGCGTAAGAAGATCAGATGTAGATGCACAAAAGAGAAATAACCACATTGATCAACAAGGGTGCTCCAAGTGGAAGATTTGCTAGGGTAAAATGGATAGATAAGATAAGATACTATAATTCATTTAATGTCCAACAAATGACCACAAAAGTAGGTCAATGGGATTGTCGAGTACAATAATGTCGATACAAAGCAGGAGCACTAAAATGTCTCCTATATAATGAGTAAGATAAAAAGTAAAGTAAAGCCCGAGATCTATGTTAAAGCATGAAAAACCCTCGACTTTGAGTATGGGCGACAACACTGGGCTTGGTAAAGGATCCATGAATTGGAGATGGTGGTCCACTAGATCTATCTCTCCTAAAATCTGAGGCCAAATGAGAAGACTCAAGATAGAATGATGCCTCAAGGAAGAACTGGGGGAAGATTTGGATTGGCCACCACGCCACTGTTTGGAAGAGGTAACTCTCTGTTGATGCTTGGGTGATCTTGTCTGCCTCATGTTAATGGATTTGGTTTGGCAATGTTGTTGAGATGTCTGGGGAAGGGGGATGGTCCCTTGGGTCCGCACTGATTTGGAGTTAAAGGCAATGATGCTATTAGTTTGTCTCTTAGTGCCCTTAGCTGATGGGGGAGCACTGTAAAGTTAAAGGCAATGATGCTATTAGTTTGTCTCTTAGTGCCCTTAGCTGATGGGGGAGCACTGTAAAGAAGGAATTAATCCTCTGAGTGGAATCTGGTCTAGAAGGAGGCTGGAGAATGTGGCCACAAAGCTTGAGGGCCTCTTGCATATATAGGGCCAAACATCTCTGGTTTGGGTACCTAAAGAAACTAGATAGGGTTTGGGTCCCCCCTGAATAGACAATGGAACTTCCCACATATATCCTAGTAAATGCGGTAGTGGAACATGAAGTGCTCCTTTGTCTTGACCTCACAAAGATGACACAGTTGGAAAATCCTCTTTGCTCGTTTAGTTTGGTGATCCATCTTGGCTTGAAGTCTATGCAAGCTCACTTAGAATTGGCCTAGGGGGATATAGAGAGAGTGTGCCTAATGATGAGATGTGTATGGGGGTTGGATAATGAGTCCATCCCTCACCTCTATGAAGTCCTCGACATAGAAGGCTATCTTCAAACCTAACCTCCCTAGTGACTTGCAGAAACATCTTGTAAATGTCATCTTGGATGATCCTATTCAACTCTTGCCTAGTAGGTAAGAGGTGGCCTGGTGCATCCAGGGAGTATCTGAATGGAGGAAGATGATCCATTGAAATACTAATGGACTCCAAAAGGGATGAGACCCTTGCAAACGAACACTTGGTACAACTAGGAGGGATAGATAAGGCAATGGACTCCAATGAACGAAAGTCCAAGAACATGTACTGGTTTCGATGCTTCCCTAAATCGAAGAAAATTTGAATGCAACGTAGAAGTGAAACAAGGAGGAAAATAGTTTCAAGTCGAAAGGAGGAAAGTGCTTCAAGAAAGGCAAGCAAACACCAAAACAATGCCATCAAAAAGTGTCAGTACACGAGACAAGCTTCTCAATATGGGTCTCAACAAAAATTGACTTGGTTAGGTGCCCATCTACTATCCAAGAAAGCATTACTCAATAGCCAATTGTAATGGAAGCAAACAGGAAAACAATGCCATGAAGAAGTGCCATTTATGCAAGACAAGATTTATCAATATGGGTCTCGACAAAAAATAGTTTGATTAGGTGCTCATTTACTATCCAAGAAAGCATTACTCAATAACCCCTTGTAGTGATGAATTTGGGTGTAAATAAAAGGATGATCAAATCTAACAACATCAACTTGACCACTACAAGGTCCAAAATAGTCATTGAAGTGGTACCTCAAAATCATAGTGTCTAGAAAACTAAAAGATGGTCTCGACAAATTGGCAAAGCTTAGAAGAGTTTCAGTTAGTGAGCATAGGCATAAGTGATGAAGAATGGGAGTGAAAACCCATAAATATGATGTCAAGGAGAAATCTCCAAAAGACGACTTAGAAGATGACAATGAGCATGCTAACGCGAAAGAAGATTAGACTTTGATGCACAAAATGGACAATTTGTCAAAGATCAACATAAGTGCTCTATTCATGCAAATCGACAAAACTTGGTGAAGTGAAGAGTGATTTGATTTAACTCAAGTGCCAAAGATGAACAACGATGCTTTGAGCAAGGAATGGTTGCTATAATATGTCGTCAAATGAAGAGAGTGCATAATGACCCAGAGCAAACAATGACCAAGTCCACTAAGTGTCAAATGGAATATGAATAGTTTGAAGATGAAGCAAATCTTCAGAAAGAGACATGCCACTAAGTCCATGAACCTCATTGTTTTTGTTACCCCACTCGACCTTCTTCAAGGCATCCAATGGTGCAATTTGTGTTCCCAAAGTTATCCTCAAGATTTTCTTACTTCTTAATGGATATTCCTTGGACGACTTCCATGAATATTAATTAGTATTGGTTAAGTGGATTACATTCAAATTAGCCATAATGAAGAGCATTAATCAAATGTCTATAAAAACAAAACCAATTGCACTAATGCAAAGTGTGAAAAATAACGCAATTTCAGGAAAATGTCACTAAATAGGTGTTTTTAAATGACCACGCTATGCCCTTTAGAAGTTCCAAAAGTGAGTATTAGAGGGGTTTTTATGAGAAAATGAATATGGAAGACTTTGTCTGCACTACAGAATGCCGTGCCTCCCTAGACACACTAAAATAAATTCGGTAAGCACCCTGATTTTAGTCATTCTAAATTGGGATTTGGAATTTCATGTACATGTGGATGCCTCAAGTATCACCCTGGGAGACATACTAACCCAACCAGGAGAAGGGAAAAACAAGAAGCGATAAACAATGAAATTTTCATAAACCCGTTGAGCTAGTGTGTGGAGCTAAGCTACGGGGGAGCGCCCCCCCCTCGCTTTGACTCCCGAAGCGTGCTCCCAAAGGGAGCGTTTTTCAGGGGCATGCTTCCTAGGGAAACAAAACGCTCCCTGCCTTAAAAAGTCTCTAACCATGCTTGGAAGTATAACTTTTGGGTGAATATGATGGTGATCATATTCCTGGAGGAGACATGCCATCCTCATTAACTAGCAACATTCCAAATGCATCAATTTTCGCAACGCCTATTGTCACGTGGGGGCCATTCAGTTGCTGGTCGTGTTCCATGAACACTTCCACCTACTCCTATTCCTCTTCTTCAAAGATCACGGGAGAATAAACTAGAAGTTTCTCGTGGCAAGAAGAAAACTTAGAGCATAGTACTTAGTACTTGCTACTATATACCAGATCTCTTTTTCTCTTTCCTGTTTAGAAATAGTCTCTAGAACTTAGTACTTTGTCTTGACTCTTTATTATGGCTTATTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTGAAGTTTGAAATTTGAACTATTGATTGAATCTTACAACTTTTTGGCAATAAATATGATGCTCTAGAGTCTATTTGATTTTGTGGCTGATGTTGTCTGTTAGTATGCTACAATCTATTGATGACAAATGTTTATGATTGATGTTATATGTGTACTAAATGGTTGATGCTTTAATGATCATTACTAATCCATTAGTTAAATGATCTTAGATCTATGTTTTCATGTTTTTTGCAATTGATTTGACATTTTGTATGTTTATATATATATATGCATCAATATATATAGTTTTTTGGGTAGTCTAACATGGTTGCTAATGTGGCGTTGATGTGGTGGGGTAGTTGTTGAAGTGGCACTATTGATGTGGTAGGTTTGATGATGTGGTGGTCAGGTAAGATGGCATGTGGCAAGTGATGTGGTAGTTGGGCACATTGACACATGGCACAAGGTGTTAATGCACCACTATGATGATGTGGTGTTGTTTGGACATGCGACGAAGGGTCCACTTGGTAAGAAAGAAGAGGTCCATGTGGTAGGTGCTTGTGTGTCTTGGTTCCACTGACATGTCAAGTCTTTGTGTCATTTTCATTCTGTGTGGCTTTGAGGTGGCAATGACATGGCTTGCAACTAGGCCATGTGGCACTGTCCAGTGTGAATGGTCCCAGTTAAGGTTTGCATGGAGGTTCCACATGGTGAATTGTGTGGTCTCTCGAAGGTTGAGGGTGTGAAGGTTTGTGGCAGGCATGACTACAAGAATAATGGCCAGTGGCAATGCTGCTTTCAGAAGGGTGACAATTGTCAAGGGCTGTGTAATGCCTTGAACAAGGCCAAATGTGTTGTCTCCAATAAAGGATCGATGCCCACCACATGACTAACCAATGCGAAATGACTATGTGAGAAGTTGAGCACTCACATGACAAAGGGTGGTGCGATATATCTCGACAATGAGGGCATTGACCTTAGCTAAGAACCCAATGGGGAAGGGATTGGATTGTCAGTAGTGGAAATAAGGGCCATGCAGGGGAGTCGCTCCAAGAGAAAATGGTTGTGGGTGAGATGCCCAAGGCACAACCTTGGTGATAATGCCAAGCAAGAGGGTGACTCCTCCTCAAGAAAAGGAGATGAAAAAGAGAGCAACCTAGGAGAAAAGTGTTGTCAAGGTAGTTTGGGCCACAAAATTAAGAACCTATGATGTGTTGTGGGAAAGACAAATGTTGATGTGGTTTTCTTGTTCCTTGAGAATTTGACCTACCAACTCTTTTACTTCTTTTCAAGCTTAAGCCTTACCACCCATAATTATCTTTGAATCCCTTAAGTGGTAGAAAGTCGTTTTGTGAAAATTCTGAGTGTCTTTGTTTCAAATGTAAGACTTGATTTTTGGCCAAAGGTGTTGTTGAGCCTTTCATGCGCTCTATTCGTGGCATAGCCATTTTATGTGGTGTGAACCCTCTTGTTCTTTTCCTTTGCACAATGTGGTGTCGTGTCCACGTAGAGTGCAGAGTGTCAGGAGAGAAGATCTTATCCCTGCATTTTTTCCATGCTGCACCTTCGTACCCCTCATCACTCCTCCATCGCCTCGATCCAGTCGCCCTTCGCATTGCCGCACACTCTCATCCCTCCACAAATAATTCCCCTTTGCCCTTATTTCCCTCATTCGCACATAGATGGTCATCATTGCCACGCCTCGCAACTTTGCTTTACATGCAGATGCAAAGTGCATAGAATGGTCGTTTCACTCTTAGACTATAATTCCTCCGTCCATAGGATTTGAGGTTGAAAACTTGGAATCTCGTGTTATTGCTTGGTGAGACACACCCCTTGGTTATTAAAGTTGTAGAATTGGAAATGGGAGTAATCAATGGTAACTTAACTCCATGTTTTTTCTTTGTCCTTCGAAATTGATGATGTTATTGTCTTTTGTCAGAGTTTAAGGATCTATGCCAATGGTATGATAGTATTTGTTTGGTATAATCATATCTAAGAGATGCTGTCAAGGAAAAGGGGGAAGCATTTATTGGTGACAATGAATTCTTTGGTTTAGAGTGACAATCATTCCATTGGTGAATTGCATATAGGTGGTATTTAGAGAAACTGGGGGAAGAATGCAAAAAGGACATAATGTGGACCTCAAGATTAGTGAATGCTAGATGTCTATTAGAGATTTATGACTTGCATGAAGTGGTCAAATCACGTGCATAAAAGTCAAAGAGGGAAATATGTAGGTATCCCTTACCCCTACTATTTTAAGAAGAATGGTGAAACTCCAAGAGCCTACAAGAATATTCAAAGTGTCTTAGGTTGATTCCATTCTTAACTCACACGATGGTGGATTTGCCCTTTTAAATAAATGGATGGTGCAACCCAAGCCCGAACTTGTGAAGTTGTACCAAATGGATATTATGGAGTTGGTCAACCCATATTGAGAGATGGCATCATTGTTCACCCGATTGGTTGGATAGGTGTCCACTACTTGTATGTAATCTTTGTCATTTACTATACCTTGCACAAGAAGGAGATCTTTGCTTGGGTTGAGATGGTTTCCAATGAGATTTCACACCATTTAATTGAGTATTAGAAAACCCAAAGGTTTTACATGTCCTCTTACTTAATTTTTGCATTGGTTTTCAACAAGACCATTGAGAATCTACCGATTAGGGTTGGTGTAGATCCAAATCTACCTTTGAGCTTATATATTTGTGGTACTCATTTTGGAAATAGAAAGCCTGGTACCATTTCTATGAAATACACTATTTCTTTGTGAGGAATATAATACAAACGATTTTGGGGAGAGAACTTGATTTCGACTTCATAGGCAAGAATTTTCTTGATAGGGAAGGGGAGATTTTTGGAGGAAGATAGTTCTACATATATCATGATGCATGGTTTTAAGGGAAAGTCGTTTTACTTGTCCAGGTTTGTTTGTGATCGTTTCTTCTTGGTAGAGGTTGCCAACCAATATGTGAAATGTGGAAATTTTCTTCATCTTAAGAAGAAATAATTCTTGTTTGTGCCTTGTCAATTTATTGGGGTTTTCATAAAAGGTATTATATAACTGGTTGGTAAAGCTTGAATTTTGGATTCTTTCAAATTGAGAGAGCACACTGCAGTGCCTAGATATGGCCCATAACATTTGTCTAGAACGCATTTGTTCTCCTTTGTTTACACTAAGTGCTTCCTTTGAATTTGTAGTCCTCAAAGAGGGTGGAGAAGACAATGAGGACATTGTTATTGAAGGAAACTTTGAAGACCAATCATAATTGTAGGGACCAACCCCCACCTGTAGAGTGGAAAATCTCAATCTTTTCGAAGTTTCCTTTATTGTCATAAGTTCTAATGTTGATTTAGATATCAAGAAAAGATGGGAAGAAATCATGAAGGATAATGAGAAGTATTAGGCAACTAGTATCATCTAGGAGGTAAATTATGTCGTTATTCTAAAGAAGGCACTACAACGGATTCCCCTAAAAATGCTTCAATATCGACTAAGAGGACTGCTTCTACTTAAGTAAAAAGAAAACAAATAATATCATTGGTAGTGGTTGTTGATGATTACAGTTGCGTGAGACATCCTCCAGGACACAGACTTGAGAGAGAGCCCCTTAGATGGGTGTGTGGTTTCTATTTGAGACAGAATTAGAACGTTGTGCTGGCCTCCTCCTTATAGAGAGTTGAGATGAACTCCAGATGATTCTCTTGTGTAACGCATTGAGAAAGAAGATCTACTGAGTTAGACGTGCCTGTGGCTGAGCACAGGTGAACGTGTGAATTCCCATGAGCTGGATGCATCGTTCTGAGACAAAGATGAAACGTTGTATTAACCTCCTCTGAGCAGAGAGTTGAGATGATGAACTCCAGATGACCCTCTTGTGTATGACAGTGACGAAGAAGATCTGTTGAGTTGGACGTGTTTGTGGATGAGCACAGGTGAATGTGATCCTAGTGGTTGAGCACTAGTGAGTGTGGTTCTCCTGTGAGACGCAGTGAGATAGAGAGACATCCCTCTGGCTGAGTACAAATGGATGTGCCCTTAGTGGCTGAGCACTAGTGGGTGTATGAGATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCAACCTCTCTTTGGCGGCCGCTCCTTGCTCACACAGACTTGTCTAGAGCCCGATCTGTAGCCCAATTGTCAATTCTTCCATGTAGATTTGTTCTGTAGCCCGTGCGGTCGTACTGTGTATGACGACTGCAGTCCGTACGACCACCGTACGCTGTACGAATGTTCTTTTTTAAAAATTTATCTTTACCTGCAAAGATTAATATTTTTTGTGCGCTGCAAAATTTCTCTTCCGTGCATCTGGTTTCCTTTTTAGAGATTACGCTCTGATATCATGTTAATTTTCCCTAACCGTGCACCCGACAATTAATTCCAAATAAACTAATTTATTGAATAAAAGCACAACTGGGTTTTTAACAAAACATTACAGCGGAAACAAAAAACTGGAAGCCAAACACATTGCACATGAAATTTCTGGGTAAAAAACCCCTGGAAACACCCCGAAGGGAAAAATAGTACTGTGAGATGTTTATTATTATTAATTTGGGTTCCCGTCTTGGCATAATGGCCCACTTGAGGAAAATACATTACAACAAATAGCCAAGACGTACAAACCTTAAGATCAATTCTTCGATCTTGTTGGTTAGCTGTTATCTTCCTTACTGCTCCTTTCCTCGGACCTTGCCCTGCACACTTGGATGGAAGTCCTTCTCCACCCAATCAATGAGATCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTACCCTAAATCCAAAACCCTAGATCTCCAAAGTGATCAAGGGCTGAGATTAAATCTCACATTCACTGTAGATCTAATGGCTAGGATTTAATATAATAACTAATGCCAAAAACCTTAGCATATAATTAAATTAAACTCACTATATTATAATAAGACATTGACTTACATAATTAACTTATAAAGTGAATTTCCTAAGGTTTATAGGAGTATTAATGTCTCCCACACGTTATTCACACTAACTCATGTGGGAGTACTGTTCGATTCTACCAAAACATCAACACTTCCTTCTAAGAGGAAGATAAACAATGAGCAAGAATTGTTGTCTGGAGGAAATGCTAAATGATAGGTTAATGCTGGTAGTAACATTGAAATTCTTGATGTTATGGTTGAACCTGTTTCTGGGGCTACTGCCCAAGTAAACATTGCTAAGTTGAAAGGAAATGAATGTTGCAGTAAATTATTCCTACCTTTGAACATGTTTTTGTTACCATGCATCATTCTAGTTGCATCATTCTAGTTATGATAAACCGGGTAAAAAGTTGTTGATGTCTAGAGCAGGGATTAAAGGGGAGAGTAACTGAAATAAATGATTTTGTTTTGATGCTAATGATATCAAAGATTCAGTGATTTGACAATGCGTAAAGCCTTTGGTGAATTGTTAGAGCATGCAGTTGGTGAATAGGGAGAGGAAACACAAGAGCTAAGGAATAGGGTAGCAGAATTTAAAGGGTGTTGAACCCTGAGCCTATATTTGCTGAGCCTCTCACCTCTCAAATATCTGGAGAGACTTAAGAAGATCATACTGAGAAGCCAAATAAAGTAAAAGCAACTCAGGGACTACTATACGGTGTAAGAAAGATTGTTTTAAGCAATGTCAAAGAGAGGATGACCTTGTTCTTAAACTTTTGGGGAGTCGTGAATGAAGCCTCTCTTATTACCAAATAAATCCTTTGTCTCAAGGAAATGTTGGAAAAGGAGCTAAAAAAAAGATTAAGGTTTTTGTGAGACTTATCTCAATACTTTCACCTAGAAAATAAAGTCTGCAAGTCTTCACCTGAGATAAAGGGACAATCTCCCTTCAGATAGTAGGATCATTGAGATGACAAAGGGACAATCTCCCTTTCAATACTAGGCTCATCAAGATAAGAAGGGGTTGGGACATCATAATTGAGACTATTCAAGAACTGATAGTAGCTTGGGATGGTCTTGAGCACAAGAATTCTCAACCGTTTTTCAAAGTATTTGAAGTCATGAAGAAATTGAAGGGCCCAATCCTCATTCGAGATGATAAGTTGATTGCAAAAGAAGAATTCCTAGCTGTTTTAGTTGAGAATAAGGCTGTCTAGGGACAAAAGTTAGCCATACCCACTTTTCTAACGTGAAGGTGAAGAAATGGTTGACATCCTTTGTGGTCGATAACATGGAATGTAACTGGCTATGCAAAGACTAGGTCAACATCGTATGTGGTATCTAGTATGAAATGCTCACTTTAAGATTGAGGAGGAGATTGCTGTGGCCCCACTTCAAGACTATGTTAAAACTTGGGTGGACCAAGCAGCCACTATTGCTACCAAATCATTATGAGATAAAAAGAGCAAAGACAGTTTGGTCGAGAGAGTCATTCGTGGTTCAACTAAAGGAGCATAAAAGGATCTTTCAAGGACGAGAGAAGGGTTTACAACACAACACATTTTTTCCCTCTAAATATTGTAAGAGCGATTCAGATTCCCCCTTTTTTCTAAATTTTCTACTGGCCATGCCTTTTGCCATTTGACCTCCCTATGTGTTATAACTGTGAAACACATATTAGCCCTCTTTTTTTTCTACATCCAAGATTTCTGTATTATTCTAACATGGCTGGAGCCCCATCCCAACTCAGAAGAGTAAACACAGTCTTCTCGTATAAATACTACCATAGGAACTTTGTAGAGGTTTTCCAGTCCTATTGTTTCTGATACTTTGAACAACTATTGTTTGGCATTATTATTTTTTAAAAGACCCACACAGAGATATCCAAGATTTGTATTATTCTTATGGTTCTATCTTGTTCAATTTAAGTGGAATCTTGAATATATGATCTTGTTCAAAGATCAAACCCATTTGAACGATAATGAAAAAGCCTGCAAAGTTCTCTGCCAGACTTGTATCTTTTTCTGTTCGTCTTCTTGTAAATCATGGTTTTCTCATTTACTTGTATTACATTGAGGAGGCCAAAAATCTGTGTTTGAGCATTTTTATACATATATAAAATTTTTGTTTATATTTTGTAAGTGGTTTGAAAGCTACCTGGTACAGTCTCAAGTAGGATTAAATGATTTTAAAGATTATTTGTTAATGCAAGAATAATTTTAATCTATGTGAGTTTAGAAGTTCCCGTGGGAATTTACTGCATAGTTTTTTCCTACTTCATTTGACAAGTATAAGTGAAGAGTGTCCTTCACGTAGAGGGGTGCTACTTCTTTAAAAAATAAGATTCCCCTCAGTGTTGACTCCTTTTCCTTCGTGAGAAAAAGAGATTAACAACAAAGGGTTGCCTCCCACAAAAACTTGACCTGGAACTAGAGAGCACAAAGCCAACTATACCAAGCAGGGCTGAAACAAAGGGCCATTAACAACTGCAAAATTCACCACAAAAAAAGCACTAGAAACCACCAAAAGATTTTGCCAGAAAAAATAGAACGATGGTTGNNNNNNNNNNNNNNNNNNACGATGGTTGGAAGTATTATTAAATCAAAACTTCGTAAACCAAAGCTTTTTACCCCTATTCAAATGGACGACCATGATGGAATGGAGTGAAATCTTCAGATTGGAGGCAAACAAAGTCCTATTTTGACGAAACGAAAGTCAAATCTTACTAAAAGGACCACTCCAGATAGAATGGAATGGTTAGAGTTTTAAAAAAGCACAAGAAGCCTGGATCTCCATAGGTCTGATTTGAAAACCAAAAGAAAGTATTTGAATCTCTTCAAATGCTCAAGACTGATATCAGGTCCGATCGTATAAGAAACAAATGGGACTCTGATATGCACTCGAAAAGCATTTCTAGTTGCCGCAAGCTACCTTGATTTTCAAACAAAATAGGAGTTAACTTCATAGGTGCTCTGATACCATATTGGGAAATTAATAGGTGGGTAACCACAGGAACGAACACCATAGAGAAATAGCTCACTCAAATCAAATATAGAGACAACAATTTTTACTTGGTAAAACCCTCAAATAGGGAAACAACCACGGAGCAACAAAAAAGTTGTATCATTGCCCAAGAAAGAAAGGCTACATCCAGTGCAATACTCTCTGTCATGTCGCATCATGAGTGACTGGGCCATAGGCACTTTAATACCATATTGGGAAATCAACATGTGGTTAACCACAGGGACGAAAAATAACAAATCAAAGAAAGAGACAAAAATATTTACATGGTAAAACCCTCAAAGAGGGAAATATCCATGGAGCAACAATAAAGTTGTATTACTGCTCAAGAAAGAAAGGCTACATCCAGTGCAATACTCTCCATCAAGCAGCATCACCAATGTCTGGGTCGCCAACAAATGACCCTCCATGATCTTCAAATAGATATCATAGACCAGTGAGGTGATAAGACATAGATCAACTGTCGTGAATACCAAGAATATGAGGACCATTGGATCACCTATGCACAAGATAGACTGGTGACAGTCAGATGACACAAGTACAAAAGCACACTAAAGAAACACACTAAAAGTACACGGCTAGTACATTAGACCAAGTTGGTCTTAAGAAACCTTGTAATGTCTAATATCTTACCACGTTTCTGTTTCTGCGACCAGCAATATTTGTTGTAACTCCATTTCAGACTGTTCATTAGAGTTTTTAATCAATATGAGGTGGTGATTGCAGTAAGTATATACGACTCTAATCTTGTGTGTGCAATGTGGAAATCCCCTTGTTTGCCATGATTTTTCGAGGAGATTTTATCACTATGCATATCTTAGCATTTGTTCCTTTTGATGGTGTTGTTATTTTTGGTAGAGCAGTGCAGTTATGTAGTGATGCAACATGATCCCGATGGTGGGCATCATTGTTGTCATGGTAATGATGAATGATGAATGTGAATTGTCCTGGATGTTTCTTGTGGAGTCACTGTCAAAACAATCGTGACAGGTGCATTAGGCATGAGTTTGTTGACTAGACCAGCTCTAGAATGCAACTAAATACCAATAAATCTCTTGGTACCTCTGTCTCTGTAGTCTACATTTACGTGGTTGCATGCATGCTCTTTTCTGTGTTTTATACTTCTTGTTACTGTTTATATCAATATCCATTGATTTAGCTGATTATTTTATTTAGCCTCTGCTCTAATTTTTTGAACAGCTAACTTTTTTCAGAGAGCATTTGAAATCAATTCTTGAACAAATATATGTGATAGAGCAATTAATAGAGCTGGTTTAGTGAATGAACTGTCTTACAACCTGTTGGTCTCTAGCTGTGCTATGTTTACTAATTAATCACCCATCTTTGGATTTGAGTTTAAACACCATCATATTTTTTATTTATTTGTGCAACAAAGGTTTTGTACAGAATTCCATTCATACTATTTGTTCTTTAAAACAACTACATGAACACATTTACTTGCTGATGCAGAAATAATATGGTACCATTTGAAAGTTGACTGTTGCCTTTTTGTTATCGTGCAGTACATCTGGTTGCCCATTTGGAGAGAACTGTCATTTCATGCACTATATCCCTGGCGGTATGAATTTGATTTCTCAGGTGTCAAATTTGGGAAGTGGTCTGGGCACAGCTTCAAGGAAATCAACAGGTCCCCCAACTAGCATTTTGCCTTCTGATCAGGCAGCTCCTGTACAGCCATACAAGACACGGATTTGTAATCGCTATGGGACTGCAGAAGGATGCCGGTTTGGAGATAAGTGTCATTTTGCCCACAGTGAAAATGAACTGAAGAAAGGCAATACACTTGCTCCTGTTGAGAGGGAACGGACATTAAGCAAGGATGCCGGTTTGGAGATAAGTGTCATTTTGCCCACAGTGAAAATGAACTGAAGAAAGGCAATACACTTGCTCCTGTTGAGAGGGAACGGACATTAAGCTCTTATGGCAGGCCAGTTCCTGGTGTGATGGATGGCAGGCCTGGAGGTAGACTTGTGCAGCGTGAGCCTACACCACCTGGAATGGCAGCGGCAGCTTCATTTGGTGCTTCAGCAACAGCAAAAATCAGTGTCGATGCTTCTCTTGCTGGTGCCATTATTGGAAAAGGTGGTGTAAACTCCAAGCAGATTTGTCACACAACTGGAGCAAAACTAGCTATAAGAGATCACGAATCCGATTCCAATCTAAAGAACATTGAGCTGGAAGGTAGCTTTGATCAGATAAAACTAGCCAGTACCATGGTTCATGAGCTGATAATGCAAACTAGCGCTGTAGCTGCAAAACCATCTGGATTTGTTTTCAACAATTACAAAACAAAGGTGTGTGAGAATTTTTCCCAGGGTACCTGCACATTTGGGGATCGTTGCCACTTTGCACATGGTGCCAGTGAACTTCGGTAA
   



Peptide Sequence
>MA_1151p0010[274 residues] 
MESLPTGLRSKSKACTKFFSTSGCPFGENCHFMHYIPGGMNLISQVSNLGSGLGTASRKSTGPPTSILPSDQAAPVQPYKTRICNRYGTAEGCRFGDKCHFAHSENELKKGNTLAPVERERTLSKDAVPGVMDGRPGGRLVQREPTPPGMAAAASFGASATAKISVDASLAGAIIGKGGVNSKQICHTTGAKLAIRDHESDSNLKNIELEGSFDQIKLASTMVHELIMQTSAVAAKPSGFVFNNYKTKVCENFSQGTCTFGDRCHFAHGASELR*
   



PlantGenIE GeneLists

Gene Family Genes
Amborella trichopodascaffold00022.187; scaffold00149.35; scaffold00269.3;
Arabidopsis thalianaAT5G06770; AT3G12130;
Oryza sativa ssp. japonicaOS04G57010; OS06G41384; OS02G10080;
Oryza sativa ssp. japonicaOL17G00170;
Physcomitrella patensPP00059G01660; PP00066G01040;
Picea abiesMA_159838g0010; MA_68032g0010; MA_1151g0010; MA_83924g0010; MA_8414656g0010;
Pinus taedaPITA_000059887-RA; PITA_000014089-RA; PITA_000014090-RA; PITA_000059827-RA; PITA_000005455-RA; PITA_000088084-RA; PITA_000031774-RA; PITA_000005456-RA; PITA_000032900-RA; PITA_000066266-RA; PITA_000087140-RA; PITA_000057922-RA;
Populus trichocarpaPotri.016G046600; Potri.001G013200; Potri.003G213200; Potri.T111100; Potri.006G191900;
Selaginella moellendorffiiSM00000G10060;
Vitis viniferaVV06G06800; VV08G09280; VV13G00710;
Zea maysZM02G01270; ZM10G25850; ZM04G38270; ZM06G13250; ZM09G15400; ZM01G39120; ZM06G11100;

Map Image: 


Login | © 2019 PlantGenIE.org.| All our tools are under MIT License

  • GeneList
      view active genelist () here.
      genelist namegenesrename/delete
      add new genelist / save current list / cancel
  • Analysis
  • <