00       00

Click here to search
Bug Report
Report an error

P.abies 1.0 gene MA_10432807g0010
Page views 1


Chromosome Start End Confidence Trinity id Subject length Subject coverage Subject strand Query strand
Loading data from server


Gene Description based on Blast2GO: G-type lectin S-receptor-like serine threonine- kinase SD2-5

Populus Transcript name:     Potri.004G061900.1
Arabidopsis id:     AT1G78860.1

Map Image: 


Gene Ontology values could not be found for MA_10432807g0010 gene.


PFAM ID Description
PF01453D-mannose binding lectin

CDS Sequence
Legend:   CDS        STOP                         

>MA_10432807g0010[531 nucleotides] 
TGCTTGGTAAATGCCCAGGATATTAATGGATTCCTCATCACTAACACAACTTGGTCTCTTTCAGACGAAAGTACAATTGTCAGTTCGTTGACCCTCAATAACGAAGACAACGCCACTGCATTTCTCATCACGCATATTGTTTTTCAGAGCTTCTCTTCCGGAATCAAATCCTGGTCCTTCGGTTTCATGCAAACGGGAAATAACGAGTATGTTCTGTCCATAGTGTTGTCCGGAAATAACGAATTATTTAAGCAGCAATATGGGGAGGTTGTGTGGGCTGCCAATGGAGATAAGCCCGTCTCAAGCAACGGGATTCTGGAGCTGCAGCCTGATGGGAATTTGGTACTCTCGGACTCGATTAATGGCGGGTCATCAGCTTCTGATAGGAGAACCATATGGTCTAGGAATACAGGAGCCAAGGGGGTCACAGGGATGAGACTGTTAGGGGCGGTTTGTAGGATCATGGTCAATTATCATCCCTTTAAAAGGTTTCAATGGATGATAGAATTCAAAATCTATACACCTTCATAA
   



Genomic Sequence (+ strand)     upstream:    downstream:   
Legend:   CDS                         

>MA_10432807:1-890[890 nucleotides] 
CATGGTGTTCGTAGTTTGGTAATCAAAGAATGTCTGCTTAATTAAATTGAGCCTTCCTGTTATAACTTATAACATATTTTCTTGTCCGTGTCCTCTCTGCGCTGCATCAATACTTGTGCTGTTTCTTCGGTCTGCTGTCGTTGTTCACAAACATGATGACGGACGGATCCATCAGGTTCCGTTGCAGATTAATCTGTACTCTATCGTTCATGTTAATGTTGATCCAGTGCTTGGTAAATGCCCAGGATATTAATGGATTCCTCATCACTAACACAACTTGGTCTCTTTCAGACGAAAGTACAATTGTCAGTTCGTTGACCCTCAATAACGAAGACAACGCCACTGCATTTCTCATCACGCATATTGTTTTTCAGAGCTTCTCTTCCGGAATCAAATCCTGGTCCTTCGGTTTCATGCAAACGGGAAATAACGAGTATGTTCTGTCCATAGTGTTGTCCGGAAATAACGAGTATGGGGAGGTTGTGTGGGCTGCCAATGGAGATAAGCCCGTCTCAAGCAACTAATCAAAGGAGCGATTTGCTCAATCAAAGGAGCAAATCGCTCAACTTATTCGTCTAACACTGTCCATAGTGTTGTCCAGATTATTTAAGCAGCAATATGGGGAGGTTGTGTGGGCTGCCAATGGAGATAAGCCCGTCTCAAGCAACGGGATTCTGGAGCTGCAGCCTGATGGGAATTTGGTACTCTCGGACTCGATTAATGGCGGGTCATCAGCTTCTGATAGGAGAACCATATGGTCTAGGAATACAGGAGCCAAGGGGGTCACAGGGATGAGACTGTTAGGGGCGGTTTGTAGGATCATGGTCAATTATCATCCCTTTAAAAGGTTTCAATGGATGATAGAATTCAAAATCTATACACCTTCATAA
   



Peptide Sequence
>MA_10432807p0010[176 residues] 
CLVNAQDINGFLITNTTWSLSDESTIVSSLTLNNEDNATAFLITHIVFQSFSSGIKSWSFGFMQTGNNEYVLSIVLSGNNELFKQQYGEVVWAANGDKPVSSNGILELQPDGNLVLSDSINGGSSASDRRTIWSRNTGAKGVTGMRLLGAVCRIMVNYHPFKRFQWMIEFKIYTPS*
   



PlantGenIE GeneLists

Gene Family Genes
Picea abiesMA_14085g0010; MA_28024g0010; MA_202313g0010; MA_8938533g0010; MA_497510g0010; MA_136231g0010; MA_165422g0010; MA_89151g0010; MA_40g0010; MA_213396g0010; MA_71146g0010; MA_18312g0020; MA_10432807g0010; MA_1391g0030; MA_1139525g0010; MA_8305011g0010; MA_5260910g0010; MA_117834g0010; MA_104585g0010; MA_52495g0010;
Pinus taedaPITA_000065275-RA; PITA_000073920-RA; PITA_000049787-RA; PITA_000085057-RA;

Map Image: 


Login | © 2019 PlantGenIE.org.| All our tools are under MIT License

  • GeneList
      view active genelist () here.
      genelist namegenesrename/delete
      add new genelist / save current list / cancel
  • Analysis
  • <