00       00

Click here to search
Bug Report
Report an error

P.abies 1.0 gene MA_10265740g0010
Page views 45


Chromosome Start End Confidence Trinity id Subject length Subject coverage Subject strand Query strand
Loading data from server


Gene Description based on Blast2GO: G-type lectin S-receptor-like serine threonine- kinase At1g34300

Populus Transcript name:     Potri.010G103300.1
Arabidopsis id:     AT1G34300.1

Map Image: 


GO ID Name Space Description
GO:0016772molecular_functiontransferase activity, transferring phosphorus-containing groups

PFAM ID Description
PF00069Protein kinase domain
PF00954S-locus glycoprotein family
PF01453D-mannose binding lectin
PF07714Protein tyrosine kinase
PF08276PAN-like domain
PF08567TFIIH p62 subunit, N-terminal domain
PF12662Complement Clr-like EGF-like
PF14295PAN domain

CDS Sequence
Legend:   CDS        START        STOP                         

>MA_10265740g0010[2589 nucleotides] 
ATGGACACTGCGCCACAGATTTTCCTTACAATTTTTTTAATGCAGTTGTTGATTTTGGTGGGTTGTGGGGAAGGAGGGCCACAGCATAAAAGTGAATTAGTTATCTCATCTACTCGGCTGAAAAATTCTGGTTGGAAGCCTGGGAATAACACATACCTTGTTTCCCCAAACGGAACGTTCTGTGCCGGTTTCTATAATGTTTCTCCAAATAATTATGCATTTGCTGTCTGGTATGCCCACGATCCTCAGCTAACCATGGCGTGGATGGCTAATAGAGATCATCTCGTAGGCTACAATTCTTCCTTAACCCTAAAGAATGGAATTCTCACTATATCTGACTCTGATACCCAAGTAGTATGGAGTGCGACGATCCTAGCTTCCAATGCTGGAATGGACATGCTTTTGCTGGAATCGGGGAATTTGGTCTTCAATGCAACCAATGAGAACCATGTTTGGCAGACCTTCGACTTTCCTACGTTTACTCTTCTTCCAACACAGAATTTCTCTAAGAACAGTCGCTTGGTGTCGAGGAGAAATGATAGCACATACGCTTCAGGTGTCTACATCTTCTCTGCTTCTCAGTCCAACACGCAAACGCCATCCTTGTATTATAACAGGAGTAAATTAAGATCAGATCAACTAGATTTGTATTGGGCTTGGACAGCTAATAATGCAGTAGTTAGTCTGGGCGTTGATGGGTATCTATGTTTACGCAATAATGGGAATCTTATAAGTTCAACGAACCCAAATATTTTGATGGCATCAGACAGTGGGGATCCAACCAGTCCCTTGAGAAGATTAACTTTAGACCACGATGGAAATCTCCGAATTTACAGTTGGAATGGGGACTCTTCTTCTTCTTGGGAAGTAGTGTGGGAAGCAATACAAGAGCGTTGTCAAATTCACGGCACTTGTGGAGATAACGCTATCTGCAAGACCCCTGAATTGAACGACAGTACGCCAGAATGCCAATGTCCACCAGGTTTTAATCGAAGTATTACTGATCCTCGCAGCTGCCAGAGATTTATTGAATTTCCCCAGCCTTTATGCAGTTCTAATTATCAAAGCGTCGATTATCAATTTATCCCGTTGGATTACGTTAATTTCACTGAAGAAGGCAATCAGACAAACAGGAATGTTGCGAAGTTGGAAGACTGTATGTCGGCTTGTTTGAACAACTGCAAATGTATGGGTTTCTCACACAAATTGGACGGCAGCGCGGACTGCGTCCACCATTTTAGCAGGTTACTAAATGGATATTGGTCTCCAGAATCGCAAGCGCGCATGTACTTGAAGCTGTCTGCTAAAGAGAAAAATGTCTCTAATGAAAATCCATACAGGGGCATGCTCTCTGTGGCGGAAAATGTTTGCGAGGCTGCTTTCAGTCTGCCGTTTCCGCCAAACGATTCAGACCATTCAACGCGTTATCTTATAATAATTTGCTCCATATTTGGCATCGAGCTTTTTTGTGGAGTTTTGGCTTTCTGGGCATTTCTGAGGCAGTATTCCAAATATAGAGACATAGCCGGAATATTCAGCTTCGATATTCTATTTAATCTTTCAGGCGGGGGTCCAAAGAGATTCACATACGCAGAGCTGAAAGCAGCGACTAATAATTTCAGAGATGAAGTGGGCAGAGGAGGATTCGGGACGGTGTATAGAGGTGTTCTGCCTGATCAGAGACAGATCGCAGTGAAGAAGCTCGAGAGGATATCTCAAAGCGAAGGCCAATTCTGGCCAGAGGTGACAATTATAGGGCGAATACATCATCTCAACCTTGTTCGTATGTGGGGTTTCTGCACAGAGGGTGAACACAGAATGCTTGTGTACGAGTACATACCCAACGGGTCATTAAACAAATATTTGTTTGATAACCAGAACGAAAGAGTTGTGTTGGAATGGAGCAGAAGATATCGAATAGCAGTGGGGGTAGCCCGAGCCATAGCCTACCTGCACGAAGAGTGCTTGGAATGGGTTCTCCATCGCGATATCAAACCGGAGAACATACTGCTGGACGAGGCCTTCTGTCCCAAGATCTCTGATTTTGGCCTGGCAAAGCTGGTCGAGAGAGAACGCAGTCTGAGTGTGTCGAACATCAGAGGAACTCCTGGATATCTAGCACCGGAATACTGGCGGCAAGAAAACCAACCTATTACTGCAAAAGTAGATGTATACAGTTTTGGGATAGTGCTTCTGCAGATTGTAAGCGGAAGGAAGAATCCATTCTTCAGTCAATCAGCTTTGGAGGGCGATGGATGGTTCTTTCCAAACAAGGTTTTTGAATGGGTGGTTTTAGAAAGGAATGTGGAAAAGGTCGTGGACAAAAACATTGTGAGTGGAGTAAGAGATGATCGCTTTCAGTTGGAAGCGATTGAGAGAATGGTGAAGACAGCGTTTTGGTGTATTCAGAGCCGACCGCATGATAGACCTTCCATGGGAAAGGTTGTTAAAATGCTGCAAGGAACCCTCGATGTTCCCCAACCTCCTAGGCCCGATTTCTTCGACAGGTTCTTGAACACCGAGAGGAGCGAATATGGAGATCATATACAAGAATTGCCTGCTGAGTCTGTTTCCACGCAGGAAATTTAA
   



Genomic Sequence (+ strand)     upstream:    downstream:   
Legend:   CDS                         

>MA_10265740:3550-6138[2589 nucleotides] 
ATGGACACTGCGCCACAGATTTTCCTTACAATTTTTTTAATGCAGTTGTTGATTTTGGTGGGTTGTGGGGAAGGAGGGCCACAGCATAAAAGTGAATTAGTTATCTCATCTACTCGGCTGAAAAATTCTGGTTGGAAGCCTGGGAATAACACATACCTTGTTTCCCCAAACGGAACGTTCTGTGCCGGTTTCTATAATGTTTCTCCAAATAATTATGCATTTGCTGTCTGGTATGCCCACGATCCTCAGCTAACCATGGCGTGGATGGCTAATAGAGATCATCTCGTAGGCTACAATTCTTCCTTAACCCTAAAGAATGGAATTCTCACTATATCTGACTCTGATACCCAAGTAGTATGGAGTGCGACGATCCTAGCTTCCAATGCTGGAATGGACATGCTTTTGCTGGAATCGGGGAATTTGGTCTTCAATGCAACCAATGAGAACCATGTTTGGCAGACCTTCGACTTTCCTACGTTTACTCTTCTTCCAACACAGAATTTCTCTAAGAACAGTCGCTTGGTGTCGAGGAGAAATGATAGCACATACGCTTCAGGTGTCTACATCTTCTCTGCTTCTCAGTCCAACACGCAAACGCCATCCTTGTATTATAACAGGAGTAAATTAAGATCAGATCAACTAGATTTGTATTGGGCTTGGACAGCTAATAATGCAGTAGTTAGTCTGGGCGTTGATGGGTATCTATGTTTACGCAATAATGGGAATCTTATAAGTTCAACGAACCCAAATATTTTGATGGCATCAGACAGTGGGGATCCAACCAGTCCCTTGAGAAGATTAACTTTAGACCACGATGGAAATCTCCGAATTTACAGTTGGAATGGGGACTCTTCTTCTTCTTGGGAAGTAGTGTGGGAAGCAATACAAGAGCGTTGTCAAATTCACGGCACTTGTGGAGATAACGCTATCTGCAAGACCCCTGAATTGAACGACAGTACGCCAGAATGCCAATGTCCACCAGGTTTTAATCGAAGTATTACTGATCCTCGCAGCTGCCAGAGATTTATTGAATTTCCCCAGCCTTTATGCAGTTCTAATTATCAAAGCGTCGATTATCAATTTATCCCGTTGGATTACGTTAATTTCACTGAAGAAGGCAATCAGACAAACAGGAATGTTGCGAAGTTGGAAGACTGTATGTCGGCTTGTTTGAACAACTGCAAATGTATGGGTTTCTCACACAAATTGGACGGCAGCGCGGACTGCGTCCACCATTTTAGCAGGTTACTAAATGGATATTGGTCTCCAGAATCGCAAGCGCGCATGTACTTGAAGCTGTCTGCTAAAGAGAAAAATGTCTCTAATGAAAATCCATACAGGGGCATGCTCTCTGTGGCGGAAAATGTTTGCGAGGCTGCTTTCAGTCTGCCGTTTCCGCCAAACGATTCAGACCATTCAACGCGTTATCTTATAATAATTTGCTCCATATTTGGCATCGAGCTTTTTTGTGGAGTTTTGGCTTTCTGGGCATTTCTGAGGCAGTATTCCAAATATAGAGACATAGCCGGAATATTCAGCTTCGATATTCTATTTAATCTTTCAGGCGGGGGTCCAAAGAGATTCACATACGCAGAGCTGAAAGCAGCGACTAATAATTTCAGAGATGAAGTGGGCAGAGGAGGATTCGGGACGGTGTATAGAGGTGTTCTGCCTGATCAGAGACAGATCGCAGTGAAGAAGCTCGAGAGGATATCTCAAAGCGAAGGCCAATTCTGGCCAGAGGTGACAATTATAGGGCGAATACATCATCTCAACCTTGTTCGTATGTGGGGTTTCTGCACAGAGGGTGAACACAGAATGCTTGTGTACGAGTACATACCCAACGGGTCATTAAACAAATATTTGTTTGATAACCAGAACGAAAGAGTTGTGTTGGAATGGAGCAGAAGATATCGAATAGCAGTGGGGGTAGCCCGAGCCATAGCCTACCTGCACGAAGAGTGCTTGGAATGGGTTCTCCATCGCGATATCAAACCGGAGAACATACTGCTGGACGAGGCCTTCTGTCCCAAGATCTCTGATTTTGGCCTGGCAAAGCTGGTCGAGAGAGAACGCAGTCTGAGTGTGTCGAACATCAGAGGAACTCCTGGATATCTAGCACCGGAATACTGGCGGCAAGAAAACCAACCTATTACTGCAAAAGTAGATGTATACAGTTTTGGGATAGTGCTTCTGCAGATTGTAAGCGGAAGGAAGAATCCATTCTTCAGTCAATCAGCTTTGGAGGGCGATGGATGGTTCTTTCCAAACAAGGTTTTTGAATGGGTGGTTTTAGAAAGGAATGTGGAAAAGGTCGTGGACAAAAACATTGTGAGTGGAGTAAGAGATGATCGCTTTCAGTTGGAAGCGATTGAGAGAATGGTGAAGACAGCGTTTTGGTGTATTCAGAGCCGACCGCATGATAGACCTTCCATGGGAAAGGTTGTTAAAATGCTGCAAGGAACCCTCGATGTTCCCCAACCTCCTAGGCCCGATTTCTTCGACAGGTTCTTGAACACCGAGAGGAGCGAATATGGAGATCATATACAAGAATTGCCTGCTGAGTCTGTTTCCACGCAGGAAATTTAA
   



Peptide Sequence
>MA_10265740p0010[862 residues] 
MDTAPQIFLTIFLMQLLILVGCGEGGPQHKSELVISSTRLKNSGWKPGNNTYLVSPNGTFCAGFYNVSPNNYAFAVWYAHDPQLTMAWMANRDHLVGYNSSLTLKNGILTISDSDTQVVWSATILASNAGMDMLLLESGNLVFNATNENHVWQTFDFPTFTLLPTQNFSKNSRLVSRRNDSTYASGVYIFSASQSNTQTPSLYYNRSKLRSDQLDLYWAWTANNAVVSLGVDGYLCLRNNGNLISSTNPNILMASDSGDPTSPLRRLTLDHDGNLRIYSWNGDSSSSWEVVWEAIQERCQIHGTCGDNAICKTPELNDSTPECQCPPGFNRSITDPRSCQRFIEFPQPLCSSNYQSVDYQFIPLDYVNFTEEGNQTNRNVAKLEDCMSACLNNCKCMGFSHKLDGSADCVHHFSRLLNGYWSPESQARMYLKLSAKEKNVSNENPYRGMLSVAENVCEAAFSLPFPPNDSDHSTRYLIIICSIFGIELFCGVLAFWAFLRQYSKYRDIAGIFSFDILFNLSGGGPKRFTYAELKAATNNFRDEVGRGGFGTVYRGVLPDQRQIAVKKLERISQSEGQFWPEVTIIGRIHHLNLVRMWGFCTEGEHRMLVYEYIPNGSLNKYLFDNQNERVVLEWSRRYRIAVGVARAIAYLHEECLEWVLHRDIKPENILLDEAFCPKISDFGLAKLVERERSLSVSNIRGTPGYLAPEYWRQENQPITAKVDVYSFGIVLLQIVSGRKNPFFSQSALEGDGWFFPNKVFEWVVLERNVEKVVDKNIVSGVRDDRFQLEAIERMVKTAFWCIQSRPHDRPSMGKVVKMLQGTLDVPQPPRPDFFDRFLNTERSEYGDHIQELPAESVSTQEI*
   



PlantGenIE GeneLists

Gene Family Genes
Picea abiesMA_10265740g0010; MA_8866128g0010; MA_295572g0010; MA_7034880g0010;
Pinus taedaPITA_000014808-RA; PITA_000063892-RA; PITA_000091742-RA; PITA_000000815-RA; PITA_000071797-RA; PITA_000096408-RA; PITA_000053209-RA; PITA_000066115-RA; PITA_000066116-RA; PITA_000071796-RA;

Map Image: 


Login | © 2019 PlantGenIE.org.| All our tools are under MIT License

  • GeneList
      view active genelist () here.
      genelist namegenesrename/delete
      add new genelist / save current list / cancel
  • Analysis
  • <